ID: 1144351218

View in Genome Browser
Species Human (GRCh38)
Location 17:14398710-14398732
Sequence ATCTATCTGGATTTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144351218_1144351225 23 Left 1144351218 17:14398710-14398732 CCAGACACAAAATCCAGATAGAT No data
Right 1144351225 17:14398756-14398778 CTATTTTGGGGAGCTGATTTTGG No data
1144351218_1144351224 11 Left 1144351218 17:14398710-14398732 CCAGACACAAAATCCAGATAGAT No data
Right 1144351224 17:14398744-14398766 AGGTGTCAGGCTCTATTTTGGGG No data
1144351218_1144351221 -2 Left 1144351218 17:14398710-14398732 CCAGACACAAAATCCAGATAGAT No data
Right 1144351221 17:14398731-14398753 ATAGCTTTGATTAAGGTGTCAGG No data
1144351218_1144351220 -9 Left 1144351218 17:14398710-14398732 CCAGACACAAAATCCAGATAGAT No data
Right 1144351220 17:14398724-14398746 CAGATAGATAGCTTTGATTAAGG No data
1144351218_1144351222 9 Left 1144351218 17:14398710-14398732 CCAGACACAAAATCCAGATAGAT No data
Right 1144351222 17:14398742-14398764 TAAGGTGTCAGGCTCTATTTTGG No data
1144351218_1144351223 10 Left 1144351218 17:14398710-14398732 CCAGACACAAAATCCAGATAGAT No data
Right 1144351223 17:14398743-14398765 AAGGTGTCAGGCTCTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144351218 Original CRISPR ATCTATCTGGATTTTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr