ID: 1144354281

View in Genome Browser
Species Human (GRCh38)
Location 17:14429266-14429288
Sequence AACCAGAGCTTGCACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144354279_1144354281 -5 Left 1144354279 17:14429248-14429270 CCTCAAAGTCCGCTTAGAAACCA No data
Right 1144354281 17:14429266-14429288 AACCAGAGCTTGCACCAGCCTGG No data
1144354278_1144354281 7 Left 1144354278 17:14429236-14429258 CCTAAGAGAAGACCTCAAAGTCC No data
Right 1144354281 17:14429266-14429288 AACCAGAGCTTGCACCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144354281 Original CRISPR AACCAGAGCTTGCACCAGCC TGG Intergenic
No off target data available for this crispr