ID: 1144354724

View in Genome Browser
Species Human (GRCh38)
Location 17:14434424-14434446
Sequence TAGGAGATGCATCCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144354717_1144354724 27 Left 1144354717 17:14434374-14434396 CCGAAGGCTGAAGCTGTGCGGGA No data
Right 1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144354724 Original CRISPR TAGGAGATGCATCCTGAGGA AGG Intergenic
No off target data available for this crispr