ID: 1144355162

View in Genome Browser
Species Human (GRCh38)
Location 17:14438335-14438357
Sequence CTGATCCTATGTAAGAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144355157_1144355162 3 Left 1144355157 17:14438309-14438331 CCCAATTGCCTGGTAGATCTTTG No data
Right 1144355162 17:14438335-14438357 CTGATCCTATGTAAGAACTGGGG No data
1144355158_1144355162 2 Left 1144355158 17:14438310-14438332 CCAATTGCCTGGTAGATCTTTGT No data
Right 1144355162 17:14438335-14438357 CTGATCCTATGTAAGAACTGGGG No data
1144355159_1144355162 -5 Left 1144355159 17:14438317-14438339 CCTGGTAGATCTTTGTGTCTGAT No data
Right 1144355162 17:14438335-14438357 CTGATCCTATGTAAGAACTGGGG No data
1144355156_1144355162 4 Left 1144355156 17:14438308-14438330 CCCCAATTGCCTGGTAGATCTTT No data
Right 1144355162 17:14438335-14438357 CTGATCCTATGTAAGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144355162 Original CRISPR CTGATCCTATGTAAGAACTG GGG Intergenic
No off target data available for this crispr