ID: 1144357252

View in Genome Browser
Species Human (GRCh38)
Location 17:14458084-14458106
Sequence CCATTAAGGTTCCTGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144357252_1144357261 25 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357261 17:14458132-14458154 GGTATCCCATAGGGTTACGTGGG No data
1144357252_1144357257 15 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357257 17:14458122-14458144 GACAGCCACTGGTATCCCATAGG No data
1144357252_1144357260 24 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357260 17:14458131-14458153 TGGTATCCCATAGGGTTACGTGG No data
1144357252_1144357258 16 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357258 17:14458123-14458145 ACAGCCACTGGTATCCCATAGGG No data
1144357252_1144357256 4 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357256 17:14458111-14458133 GTTTCTCTGAGGACAGCCACTGG No data
1144357252_1144357255 -7 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357255 17:14458100-14458122 TTAATGGTTCAGTTTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144357252 Original CRISPR CCATTAAGGTTCCTGAAACC AGG (reversed) Intergenic
No off target data available for this crispr