ID: 1144357255

View in Genome Browser
Species Human (GRCh38)
Location 17:14458100-14458122
Sequence TTAATGGTTCAGTTTCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144357246_1144357255 19 Left 1144357246 17:14458058-14458080 CCCTGTACTCTGCCTGGATCCTG No data
Right 1144357255 17:14458100-14458122 TTAATGGTTCAGTTTCTCTGAGG No data
1144357251_1144357255 0 Left 1144357251 17:14458077-14458099 CCTGTATCCTGGTTTCAGGAACC No data
Right 1144357255 17:14458100-14458122 TTAATGGTTCAGTTTCTCTGAGG No data
1144357252_1144357255 -7 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357255 17:14458100-14458122 TTAATGGTTCAGTTTCTCTGAGG No data
1144357247_1144357255 18 Left 1144357247 17:14458059-14458081 CCTGTACTCTGCCTGGATCCTGT No data
Right 1144357255 17:14458100-14458122 TTAATGGTTCAGTTTCTCTGAGG No data
1144357244_1144357255 30 Left 1144357244 17:14458047-14458069 CCTCATCTCTGCCCTGTACTCTG No data
Right 1144357255 17:14458100-14458122 TTAATGGTTCAGTTTCTCTGAGG No data
1144357249_1144357255 7 Left 1144357249 17:14458070-14458092 CCTGGATCCTGTATCCTGGTTTC No data
Right 1144357255 17:14458100-14458122 TTAATGGTTCAGTTTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144357255 Original CRISPR TTAATGGTTCAGTTTCTCTG AGG Intergenic