ID: 1144357256

View in Genome Browser
Species Human (GRCh38)
Location 17:14458111-14458133
Sequence GTTTCTCTGAGGACAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144357254_1144357256 -10 Left 1144357254 17:14458098-14458120 CCTTAATGGTTCAGTTTCTCTGA No data
Right 1144357256 17:14458111-14458133 GTTTCTCTGAGGACAGCCACTGG No data
1144357247_1144357256 29 Left 1144357247 17:14458059-14458081 CCTGTACTCTGCCTGGATCCTGT No data
Right 1144357256 17:14458111-14458133 GTTTCTCTGAGGACAGCCACTGG No data
1144357246_1144357256 30 Left 1144357246 17:14458058-14458080 CCCTGTACTCTGCCTGGATCCTG No data
Right 1144357256 17:14458111-14458133 GTTTCTCTGAGGACAGCCACTGG No data
1144357249_1144357256 18 Left 1144357249 17:14458070-14458092 CCTGGATCCTGTATCCTGGTTTC No data
Right 1144357256 17:14458111-14458133 GTTTCTCTGAGGACAGCCACTGG No data
1144357252_1144357256 4 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357256 17:14458111-14458133 GTTTCTCTGAGGACAGCCACTGG No data
1144357251_1144357256 11 Left 1144357251 17:14458077-14458099 CCTGTATCCTGGTTTCAGGAACC No data
Right 1144357256 17:14458111-14458133 GTTTCTCTGAGGACAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144357256 Original CRISPR GTTTCTCTGAGGACAGCCAC TGG Intergenic