ID: 1144357257

View in Genome Browser
Species Human (GRCh38)
Location 17:14458122-14458144
Sequence GACAGCCACTGGTATCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144357252_1144357257 15 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357257 17:14458122-14458144 GACAGCCACTGGTATCCCATAGG No data
1144357254_1144357257 1 Left 1144357254 17:14458098-14458120 CCTTAATGGTTCAGTTTCTCTGA No data
Right 1144357257 17:14458122-14458144 GACAGCCACTGGTATCCCATAGG No data
1144357249_1144357257 29 Left 1144357249 17:14458070-14458092 CCTGGATCCTGTATCCTGGTTTC No data
Right 1144357257 17:14458122-14458144 GACAGCCACTGGTATCCCATAGG No data
1144357251_1144357257 22 Left 1144357251 17:14458077-14458099 CCTGTATCCTGGTTTCAGGAACC No data
Right 1144357257 17:14458122-14458144 GACAGCCACTGGTATCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144357257 Original CRISPR GACAGCCACTGGTATCCCAT AGG Intergenic