ID: 1144357260

View in Genome Browser
Species Human (GRCh38)
Location 17:14458131-14458153
Sequence TGGTATCCCATAGGGTTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144357254_1144357260 10 Left 1144357254 17:14458098-14458120 CCTTAATGGTTCAGTTTCTCTGA No data
Right 1144357260 17:14458131-14458153 TGGTATCCCATAGGGTTACGTGG No data
1144357252_1144357260 24 Left 1144357252 17:14458084-14458106 CCTGGTTTCAGGAACCTTAATGG No data
Right 1144357260 17:14458131-14458153 TGGTATCCCATAGGGTTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144357260 Original CRISPR TGGTATCCCATAGGGTTACG TGG Intergenic