ID: 1144357260 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:14458131-14458153 |
Sequence | TGGTATCCCATAGGGTTACG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1144357254_1144357260 | 10 | Left | 1144357254 | 17:14458098-14458120 | CCTTAATGGTTCAGTTTCTCTGA | No data | ||
Right | 1144357260 | 17:14458131-14458153 | TGGTATCCCATAGGGTTACGTGG | No data | ||||
1144357252_1144357260 | 24 | Left | 1144357252 | 17:14458084-14458106 | CCTGGTTTCAGGAACCTTAATGG | No data | ||
Right | 1144357260 | 17:14458131-14458153 | TGGTATCCCATAGGGTTACGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1144357260 | Original CRISPR | TGGTATCCCATAGGGTTACG TGG | Intergenic | ||