ID: 1144359180

View in Genome Browser
Species Human (GRCh38)
Location 17:14475533-14475555
Sequence CCCCCAGGGTCCCCATAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144359175_1144359180 30 Left 1144359175 17:14475480-14475502 CCTTTGATGAAACACCTTCAGTG No data
Right 1144359180 17:14475533-14475555 CCCCCAGGGTCCCCATAGTCTGG No data
1144359176_1144359180 16 Left 1144359176 17:14475494-14475516 CCTTCAGTGACTTTTCATTTCAT No data
Right 1144359180 17:14475533-14475555 CCCCCAGGGTCCCCATAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144359180 Original CRISPR CCCCCAGGGTCCCCATAGTC TGG Intergenic
No off target data available for this crispr