ID: 1144362407

View in Genome Browser
Species Human (GRCh38)
Location 17:14507879-14507901
Sequence TGCAAGGCATAGATCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144362402_1144362407 -8 Left 1144362402 17:14507864-14507886 CCCACTGTATGAAAATGCAAGGC No data
Right 1144362407 17:14507879-14507901 TGCAAGGCATAGATCTGGAGGGG No data
1144362400_1144362407 3 Left 1144362400 17:14507853-14507875 CCAGAGGAGGACCCACTGTATGA No data
Right 1144362407 17:14507879-14507901 TGCAAGGCATAGATCTGGAGGGG No data
1144362403_1144362407 -9 Left 1144362403 17:14507865-14507887 CCACTGTATGAAAATGCAAGGCA No data
Right 1144362407 17:14507879-14507901 TGCAAGGCATAGATCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144362407 Original CRISPR TGCAAGGCATAGATCTGGAG GGG Intergenic
No off target data available for this crispr