ID: 1144369875

View in Genome Browser
Species Human (GRCh38)
Location 17:14579893-14579915
Sequence AATCACTCTCTACCAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144369875_1144369879 10 Left 1144369875 17:14579893-14579915 CCCTTCCTTGGTAGAGAGTGATT No data
Right 1144369879 17:14579926-14579948 GCCCTGAGAACAGAAGTGAAAGG No data
1144369875_1144369882 28 Left 1144369875 17:14579893-14579915 CCCTTCCTTGGTAGAGAGTGATT No data
Right 1144369882 17:14579944-14579966 AAAGGTTAAGCTCACAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144369875 Original CRISPR AATCACTCTCTACCAAGGAA GGG (reversed) Intergenic
No off target data available for this crispr