ID: 1144372485

View in Genome Browser
Species Human (GRCh38)
Location 17:14605427-14605449
Sequence CTGAGTCCCCAAAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144372485_1144372494 19 Left 1144372485 17:14605427-14605449 CCCACTTCTCTTTGGGGACTCAG No data
Right 1144372494 17:14605469-14605491 TTCTCCAGGCCCAGTTTGGTTGG No data
1144372485_1144372488 5 Left 1144372485 17:14605427-14605449 CCCACTTCTCTTTGGGGACTCAG No data
Right 1144372488 17:14605455-14605477 ATGTCACTTCCCCCTTCTCCAGG No data
1144372485_1144372491 15 Left 1144372485 17:14605427-14605449 CCCACTTCTCTTTGGGGACTCAG No data
Right 1144372491 17:14605465-14605487 CCCCTTCTCCAGGCCCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144372485 Original CRISPR CTGAGTCCCCAAAGAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr