ID: 1144373709

View in Genome Browser
Species Human (GRCh38)
Location 17:14618170-14618192
Sequence CTCGGGTCTCAGCCCTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144373698_1144373709 22 Left 1144373698 17:14618125-14618147 CCCTGTTCTAACACCTTTTCCTG No data
Right 1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG No data
1144373700_1144373709 9 Left 1144373700 17:14618138-14618160 CCTTTTCCTGCCCTGTTACCTCC No data
Right 1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG No data
1144373699_1144373709 21 Left 1144373699 17:14618126-14618148 CCTGTTCTAACACCTTTTCCTGC No data
Right 1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG No data
1144373707_1144373709 -9 Left 1144373707 17:14618156-14618178 CCTCCTGGTCAGCTCTCGGGTCT No data
Right 1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG No data
1144373703_1144373709 -1 Left 1144373703 17:14618148-14618170 CCCTGTTACCTCCTGGTCAGCTC No data
Right 1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG No data
1144373704_1144373709 -2 Left 1144373704 17:14618149-14618171 CCTGTTACCTCCTGGTCAGCTCT No data
Right 1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG No data
1144373702_1144373709 3 Left 1144373702 17:14618144-14618166 CCTGCCCTGTTACCTCCTGGTCA No data
Right 1144373709 17:14618170-14618192 CTCGGGTCTCAGCCCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144373709 Original CRISPR CTCGGGTCTCAGCCCTGCCA TGG Intergenic
No off target data available for this crispr