ID: 1144377681

View in Genome Browser
Species Human (GRCh38)
Location 17:14661700-14661722
Sequence CCTCATTGGCAGTGATTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144377679_1144377681 -10 Left 1144377679 17:14661687-14661709 CCTTGGAGGTTTGCCTCATTGGC No data
Right 1144377681 17:14661700-14661722 CCTCATTGGCAGTGATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144377681 Original CRISPR CCTCATTGGCAGTGATTCTC AGG Intergenic
No off target data available for this crispr