ID: 1144382690

View in Genome Browser
Species Human (GRCh38)
Location 17:14718438-14718460
Sequence CAGGCTAAAGTCACTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144382688_1144382690 -6 Left 1144382688 17:14718421-14718443 CCGCTACATTGATGTTTCAGGCT No data
Right 1144382690 17:14718438-14718460 CAGGCTAAAGTCACTGGAGATGG No data
1144382685_1144382690 17 Left 1144382685 17:14718398-14718420 CCCTCTTGGTATGCTCTTGAAAT No data
Right 1144382690 17:14718438-14718460 CAGGCTAAAGTCACTGGAGATGG No data
1144382686_1144382690 16 Left 1144382686 17:14718399-14718421 CCTCTTGGTATGCTCTTGAAATC No data
Right 1144382690 17:14718438-14718460 CAGGCTAAAGTCACTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144382690 Original CRISPR CAGGCTAAAGTCACTGGAGA TGG Intergenic
No off target data available for this crispr