ID: 1144383994

View in Genome Browser
Species Human (GRCh38)
Location 17:14731741-14731763
Sequence GTGAAAAACAGGAAGACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144383994_1144383999 -3 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144383999 17:14731761-14731783 CACACTGGTTAGATGGCCTTGGG No data
1144383994_1144384005 28 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144384005 17:14731792-14731814 ACTCATGGCTTCCTGGGGACTGG No data
1144383994_1144384004 23 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144384004 17:14731787-14731809 CTGTCACTCATGGCTTCCTGGGG No data
1144383994_1144383998 -4 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144383998 17:14731760-14731782 TCACACTGGTTAGATGGCCTTGG No data
1144383994_1144384001 13 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144384001 17:14731777-14731799 CCTTGGGCTACTGTCACTCATGG No data
1144383994_1144383997 -10 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144383997 17:14731754-14731776 TGTTTTTCACACTGGTTAGATGG No data
1144383994_1144384002 21 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144384002 17:14731785-14731807 TACTGTCACTCATGGCTTCCTGG No data
1144383994_1144384003 22 Left 1144383994 17:14731741-14731763 CCAGTAGTCTTCCTGTTTTTCAC No data
Right 1144384003 17:14731786-14731808 ACTGTCACTCATGGCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144383994 Original CRISPR GTGAAAAACAGGAAGACTAC TGG (reversed) Intergenic
No off target data available for this crispr