ID: 1144385844

View in Genome Browser
Species Human (GRCh38)
Location 17:14748493-14748515
Sequence GCACTGAGTCATGTCTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144385844_1144385848 -9 Left 1144385844 17:14748493-14748515 CCCTTACAGACATGACTCAGTGC No data
Right 1144385848 17:14748507-14748529 ACTCAGTGCAGGTAGGAGCCAGG No data
1144385844_1144385852 28 Left 1144385844 17:14748493-14748515 CCCTTACAGACATGACTCAGTGC No data
Right 1144385852 17:14748544-14748566 AGCTTCTTAGCAGAGCATTTGGG No data
1144385844_1144385851 27 Left 1144385844 17:14748493-14748515 CCCTTACAGACATGACTCAGTGC No data
Right 1144385851 17:14748543-14748565 AAGCTTCTTAGCAGAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144385844 Original CRISPR GCACTGAGTCATGTCTGTAA GGG (reversed) Intergenic