ID: 1144387310

View in Genome Browser
Species Human (GRCh38)
Location 17:14760873-14760895
Sequence AGCTCAACTCTGCTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144387310_1144387315 7 Left 1144387310 17:14760873-14760895 CCAGTCAGCAGCAGAGTTGAGCT No data
Right 1144387315 17:14760903-14760925 CCAGAACCTGACACTGTCCAGGG No data
1144387310_1144387313 6 Left 1144387310 17:14760873-14760895 CCAGTCAGCAGCAGAGTTGAGCT No data
Right 1144387313 17:14760902-14760924 CCCAGAACCTGACACTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144387310 Original CRISPR AGCTCAACTCTGCTGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr