ID: 1144387386

View in Genome Browser
Species Human (GRCh38)
Location 17:14761386-14761408
Sequence TTGTGAGAAAGTAAGTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144387382_1144387386 1 Left 1144387382 17:14761362-14761384 CCCTCAAGCCAGGCTTCTTGGAG No data
Right 1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG No data
1144387384_1144387386 -7 Left 1144387384 17:14761370-14761392 CCAGGCTTCTTGGAGCTTGTGAG No data
Right 1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG No data
1144387380_1144387386 9 Left 1144387380 17:14761354-14761376 CCTGTGGTCCCTCAAGCCAGGCT No data
Right 1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG No data
1144387383_1144387386 0 Left 1144387383 17:14761363-14761385 CCTCAAGCCAGGCTTCTTGGAGC No data
Right 1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144387386 Original CRISPR TTGTGAGAAAGTAAGTAAGT GGG Intergenic
No off target data available for this crispr