ID: 1144389314

View in Genome Browser
Species Human (GRCh38)
Location 17:14778936-14778958
Sequence CAGTCCCAGCACCTGAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144389309_1144389314 8 Left 1144389309 17:14778905-14778927 CCAGGTTGCCCAGAAGAGGATCA No data
Right 1144389314 17:14778936-14778958 CAGTCCCAGCACCTGAACCCAGG No data
1144389307_1144389314 19 Left 1144389307 17:14778894-14778916 CCTAGATACAGCCAGGTTGCCCA No data
Right 1144389314 17:14778936-14778958 CAGTCCCAGCACCTGAACCCAGG No data
1144389310_1144389314 0 Left 1144389310 17:14778913-14778935 CCCAGAAGAGGATCACAATATCC No data
Right 1144389314 17:14778936-14778958 CAGTCCCAGCACCTGAACCCAGG No data
1144389311_1144389314 -1 Left 1144389311 17:14778914-14778936 CCAGAAGAGGATCACAATATCCC No data
Right 1144389314 17:14778936-14778958 CAGTCCCAGCACCTGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144389314 Original CRISPR CAGTCCCAGCACCTGAACCC AGG Intergenic
No off target data available for this crispr