ID: 1144389748

View in Genome Browser
Species Human (GRCh38)
Location 17:14783002-14783024
Sequence TTTAATGTGCATAGCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144389745_1144389748 4 Left 1144389745 17:14782975-14782997 CCACAAGAGAAAAAGGCAGAAAC No data
Right 1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144389748 Original CRISPR TTTAATGTGCATAGCGTGGA GGG Intergenic
No off target data available for this crispr