ID: 1144391428

View in Genome Browser
Species Human (GRCh38)
Location 17:14797152-14797174
Sequence GGTAAATATATAAAATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144391428_1144391430 4 Left 1144391428 17:14797152-14797174 CCATGTGATTTTATATATTTACC No data
Right 1144391430 17:14797179-14797201 TTCTGCCAACTCTGCTTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144391428 Original CRISPR GGTAAATATATAAAATCACA TGG (reversed) Intergenic
No off target data available for this crispr