ID: 1144391430

View in Genome Browser
Species Human (GRCh38)
Location 17:14797179-14797201
Sequence TTCTGCCAACTCTGCTTTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144391428_1144391430 4 Left 1144391428 17:14797152-14797174 CCATGTGATTTTATATATTTACC No data
Right 1144391430 17:14797179-14797201 TTCTGCCAACTCTGCTTTTACGG No data
1144391427_1144391430 5 Left 1144391427 17:14797151-14797173 CCCATGTGATTTTATATATTTAC No data
Right 1144391430 17:14797179-14797201 TTCTGCCAACTCTGCTTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144391430 Original CRISPR TTCTGCCAACTCTGCTTTTA CGG Intergenic
No off target data available for this crispr