ID: 1144392937

View in Genome Browser
Species Human (GRCh38)
Location 17:14812871-14812893
Sequence CACTATCATCCGAGGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144392937_1144392941 3 Left 1144392937 17:14812871-14812893 CCCTTCAGCCTCGGATGATAGTG No data
Right 1144392941 17:14812897-14812919 TCCTGTTCTTACTACTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144392937 Original CRISPR CACTATCATCCGAGGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr