ID: 1144398242

View in Genome Browser
Species Human (GRCh38)
Location 17:14867102-14867124
Sequence CTGTATCTGTAGCAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144398235_1144398242 11 Left 1144398235 17:14867068-14867090 CCCCATAACCTTTGCTCTCAGGT No data
Right 1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG No data
1144398236_1144398242 10 Left 1144398236 17:14867069-14867091 CCCATAACCTTTGCTCTCAGGTC No data
Right 1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG No data
1144398237_1144398242 9 Left 1144398237 17:14867070-14867092 CCATAACCTTTGCTCTCAGGTCT No data
Right 1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG No data
1144398233_1144398242 29 Left 1144398233 17:14867050-14867072 CCAGCATTGACATGGCGGCCCCA No data
Right 1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG No data
1144398232_1144398242 30 Left 1144398232 17:14867049-14867071 CCCAGCATTGACATGGCGGCCCC No data
Right 1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG No data
1144398239_1144398242 3 Left 1144398239 17:14867076-14867098 CCTTTGCTCTCAGGTCTGTGGTG No data
Right 1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144398242 Original CRISPR CTGTATCTGTAGCAGGAAGA GGG Intergenic
No off target data available for this crispr