ID: 1144398517

View in Genome Browser
Species Human (GRCh38)
Location 17:14870468-14870490
Sequence TAGGCTAAGGAGGAGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144398509_1144398517 -5 Left 1144398509 17:14870450-14870472 CCTTGTCTTCATGTAGAGTAGGC No data
Right 1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144398517 Original CRISPR TAGGCTAAGGAGGAGGGAGG GGG Intergenic
No off target data available for this crispr