ID: 1144401247

View in Genome Browser
Species Human (GRCh38)
Location 17:14904618-14904640
Sequence CTCTGTACGCAAGAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144401243_1144401247 11 Left 1144401243 17:14904584-14904606 CCACTGTCATTTCCTGAATGCTG No data
Right 1144401247 17:14904618-14904640 CTCTGTACGCAAGAGATGGAGGG No data
1144401244_1144401247 -1 Left 1144401244 17:14904596-14904618 CCTGAATGCTGAGTCAAAACTAC No data
Right 1144401247 17:14904618-14904640 CTCTGTACGCAAGAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144401247 Original CRISPR CTCTGTACGCAAGAGATGGA GGG Intergenic
No off target data available for this crispr