ID: 1144403079

View in Genome Browser
Species Human (GRCh38)
Location 17:14925598-14925620
Sequence GTGGAAGAGCTGATATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144403073_1144403079 8 Left 1144403073 17:14925567-14925589 CCTAGTTCCACTGGTCAGGGATG No data
Right 1144403079 17:14925598-14925620 GTGGAAGAGCTGATATTTGGAGG No data
1144403075_1144403079 1 Left 1144403075 17:14925574-14925596 CCACTGGTCAGGGATGGCTTCAT No data
Right 1144403079 17:14925598-14925620 GTGGAAGAGCTGATATTTGGAGG No data
1144403071_1144403079 11 Left 1144403071 17:14925564-14925586 CCACCTAGTTCCACTGGTCAGGG No data
Right 1144403079 17:14925598-14925620 GTGGAAGAGCTGATATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144403079 Original CRISPR GTGGAAGAGCTGATATTTGG AGG Intergenic
No off target data available for this crispr