ID: 1144403428

View in Genome Browser
Species Human (GRCh38)
Location 17:14929139-14929161
Sequence CAAAGATTCTCGGGAGATAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144403422_1144403428 30 Left 1144403422 17:14929086-14929108 CCACACTCCTACTCTAAAAGGGC No data
Right 1144403428 17:14929139-14929161 CAAAGATTCTCGGGAGATACCGG No data
1144403425_1144403428 -6 Left 1144403425 17:14929122-14929144 CCTCTGGTGCAGTTTCTCAAAGA No data
Right 1144403428 17:14929139-14929161 CAAAGATTCTCGGGAGATACCGG No data
1144403423_1144403428 23 Left 1144403423 17:14929093-14929115 CCTACTCTAAAAGGGCATCTGAG No data
Right 1144403428 17:14929139-14929161 CAAAGATTCTCGGGAGATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144403428 Original CRISPR CAAAGATTCTCGGGAGATAC CGG Intergenic
No off target data available for this crispr