ID: 1144406046

View in Genome Browser
Species Human (GRCh38)
Location 17:14953622-14953644
Sequence TCAAGGACTTTGTATTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144406040_1144406046 22 Left 1144406040 17:14953577-14953599 CCTTTGGGAATAAAGAAGTGAGC No data
Right 1144406046 17:14953622-14953644 TCAAGGACTTTGTATTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144406046 Original CRISPR TCAAGGACTTTGTATTTGGC TGG Intergenic
No off target data available for this crispr