ID: 1144409950

View in Genome Browser
Species Human (GRCh38)
Location 17:14991206-14991228
Sequence CTCGGGGTCTTGAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144409950_1144409961 9 Left 1144409950 17:14991206-14991228 CCATTTTTCCTCAAGACCCCGAG No data
Right 1144409961 17:14991238-14991260 CTTTTGCATAAGCACATTTTGGG No data
1144409950_1144409960 8 Left 1144409950 17:14991206-14991228 CCATTTTTCCTCAAGACCCCGAG No data
Right 1144409960 17:14991237-14991259 CCTTTTGCATAAGCACATTTTGG No data
1144409950_1144409962 10 Left 1144409950 17:14991206-14991228 CCATTTTTCCTCAAGACCCCGAG No data
Right 1144409962 17:14991239-14991261 TTTTGCATAAGCACATTTTGGGG No data
1144409950_1144409963 15 Left 1144409950 17:14991206-14991228 CCATTTTTCCTCAAGACCCCGAG No data
Right 1144409963 17:14991244-14991266 CATAAGCACATTTTGGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144409950 Original CRISPR CTCGGGGTCTTGAGGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr