ID: 1144410243

View in Genome Browser
Species Human (GRCh38)
Location 17:14993894-14993916
Sequence CAGGCCCCCATGGAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144410243_1144410253 0 Left 1144410243 17:14993894-14993916 CCCCAAAATTCCATGGGGGCCTG No data
Right 1144410253 17:14993917-14993939 AGGGGATTCAGGATGCTGAAGGG No data
1144410243_1144410254 12 Left 1144410243 17:14993894-14993916 CCCCAAAATTCCATGGGGGCCTG No data
Right 1144410254 17:14993929-14993951 ATGCTGAAGGGTCACCCCCTTGG No data
1144410243_1144410252 -1 Left 1144410243 17:14993894-14993916 CCCCAAAATTCCATGGGGGCCTG No data
Right 1144410252 17:14993916-14993938 GAGGGGATTCAGGATGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144410243 Original CRISPR CAGGCCCCCATGGAATTTTG GGG (reversed) Intergenic
No off target data available for this crispr