ID: 1144410989

View in Genome Browser
Species Human (GRCh38)
Location 17:15001628-15001650
Sequence ATGGCTCAACACCTCCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144410989_1144410993 5 Left 1144410989 17:15001628-15001650 CCTTGTGGGAGGTGTTGAGCCAT No data
Right 1144410993 17:15001656-15001678 CTGATCCCTCATGAATGGCTTGG No data
1144410989_1144410997 19 Left 1144410989 17:15001628-15001650 CCTTGTGGGAGGTGTTGAGCCAT No data
Right 1144410997 17:15001670-15001692 ATGGCTTGGTGCTGTCCCGGCGG No data
1144410989_1144410998 24 Left 1144410989 17:15001628-15001650 CCTTGTGGGAGGTGTTGAGCCAT No data
Right 1144410998 17:15001675-15001697 TTGGTGCTGTCCCGGCGGTACGG No data
1144410989_1144410996 16 Left 1144410989 17:15001628-15001650 CCTTGTGGGAGGTGTTGAGCCAT No data
Right 1144410996 17:15001667-15001689 TGAATGGCTTGGTGCTGTCCCGG No data
1144410989_1144410992 0 Left 1144410989 17:15001628-15001650 CCTTGTGGGAGGTGTTGAGCCAT No data
Right 1144410992 17:15001651-15001673 GTAGGCTGATCCCTCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144410989 Original CRISPR ATGGCTCAACACCTCCCACA AGG (reversed) Intergenic
No off target data available for this crispr