ID: 1144411424

View in Genome Browser
Species Human (GRCh38)
Location 17:15005684-15005706
Sequence TGTCCCAAGGAAGCACACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144411424_1144411433 22 Left 1144411424 17:15005684-15005706 CCAGCGTGTGCTTCCTTGGGACA No data
Right 1144411433 17:15005729-15005751 CTTCCAGTCTCAGCTTACATGGG No data
1144411424_1144411432 21 Left 1144411424 17:15005684-15005706 CCAGCGTGTGCTTCCTTGGGACA No data
Right 1144411432 17:15005728-15005750 GCTTCCAGTCTCAGCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144411424 Original CRISPR TGTCCCAAGGAAGCACACGC TGG (reversed) Intergenic
No off target data available for this crispr