ID: 1144412355

View in Genome Browser
Species Human (GRCh38)
Location 17:15013433-15013455
Sequence CTGCACTGGCAGCTGATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144412355_1144412358 5 Left 1144412355 17:15013433-15013455 CCTCTAATCAGCTGCCAGTGCAG No data
Right 1144412358 17:15013461-15013483 ATAAAGCAAGCAGGAGAAGATGG 0: 4
1: 55
2: 96
3: 246
4: 1107
1144412355_1144412357 -4 Left 1144412355 17:15013433-15013455 CCTCTAATCAGCTGCCAGTGCAG No data
Right 1144412357 17:15013452-15013474 GCAGCTAGTATAAAGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144412355 Original CRISPR CTGCACTGGCAGCTGATTAG AGG (reversed) Intergenic
No off target data available for this crispr