ID: 1144413523

View in Genome Browser
Species Human (GRCh38)
Location 17:15023904-15023926
Sequence TATGCAGGGGCACCCAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144413523_1144413536 30 Left 1144413523 17:15023904-15023926 CCCCTTTTGGGTGCCCCTGCATA No data
Right 1144413536 17:15023957-15023979 GCCCACAAAAGTTCTTGGTTTGG No data
1144413523_1144413533 3 Left 1144413523 17:15023904-15023926 CCCCTTTTGGGTGCCCCTGCATA No data
Right 1144413533 17:15023930-15023952 AGCAGGAGAGCCTCAAAGCGGGG No data
1144413523_1144413532 2 Left 1144413523 17:15023904-15023926 CCCCTTTTGGGTGCCCCTGCATA No data
Right 1144413532 17:15023929-15023951 CAGCAGGAGAGCCTCAAAGCGGG No data
1144413523_1144413535 25 Left 1144413523 17:15023904-15023926 CCCCTTTTGGGTGCCCCTGCATA No data
Right 1144413535 17:15023952-15023974 GCTTAGCCCACAAAAGTTCTTGG No data
1144413523_1144413531 1 Left 1144413523 17:15023904-15023926 CCCCTTTTGGGTGCCCCTGCATA No data
Right 1144413531 17:15023928-15023950 CCAGCAGGAGAGCCTCAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144413523 Original CRISPR TATGCAGGGGCACCCAAAAG GGG (reversed) Intergenic
No off target data available for this crispr