ID: 1144413752

View in Genome Browser
Species Human (GRCh38)
Location 17:15025817-15025839
Sequence CGGGTGACTCAAAGCAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144413752_1144413757 28 Left 1144413752 17:15025817-15025839 CCCTCTTTGCTTTGAGTCACCCG No data
Right 1144413757 17:15025868-15025890 AGGCTCCTATGAGCAGTCCCTGG No data
1144413752_1144413759 30 Left 1144413752 17:15025817-15025839 CCCTCTTTGCTTTGAGTCACCCG No data
Right 1144413759 17:15025870-15025892 GCTCCTATGAGCAGTCCCTGGGG No data
1144413752_1144413756 8 Left 1144413752 17:15025817-15025839 CCCTCTTTGCTTTGAGTCACCCG No data
Right 1144413756 17:15025848-15025870 TTCACTGCTCAGTGCAGCAGAGG No data
1144413752_1144413758 29 Left 1144413752 17:15025817-15025839 CCCTCTTTGCTTTGAGTCACCCG No data
Right 1144413758 17:15025869-15025891 GGCTCCTATGAGCAGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144413752 Original CRISPR CGGGTGACTCAAAGCAAAGA GGG (reversed) Intergenic
No off target data available for this crispr