ID: 1144416331

View in Genome Browser
Species Human (GRCh38)
Location 17:15050812-15050834
Sequence CAGCTCCAGGTACCTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144416331_1144416339 -5 Left 1144416331 17:15050812-15050834 CCAATGTCAGGTACCTGGAGCTG No data
Right 1144416339 17:15050830-15050852 AGCTGAGTGGGGTGGGGATGAGG No data
1144416331_1144416343 10 Left 1144416331 17:15050812-15050834 CCAATGTCAGGTACCTGGAGCTG No data
Right 1144416343 17:15050845-15050867 GGATGAGGGGAGGCTGCTGTAGG No data
1144416331_1144416345 27 Left 1144416331 17:15050812-15050834 CCAATGTCAGGTACCTGGAGCTG No data
Right 1144416345 17:15050862-15050884 TGTAGGTGGACATGAACCTTTGG No data
1144416331_1144416344 13 Left 1144416331 17:15050812-15050834 CCAATGTCAGGTACCTGGAGCTG No data
Right 1144416344 17:15050848-15050870 TGAGGGGAGGCTGCTGTAGGTGG No data
1144416331_1144416340 -4 Left 1144416331 17:15050812-15050834 CCAATGTCAGGTACCTGGAGCTG No data
Right 1144416340 17:15050831-15050853 GCTGAGTGGGGTGGGGATGAGGG No data
1144416331_1144416342 0 Left 1144416331 17:15050812-15050834 CCAATGTCAGGTACCTGGAGCTG No data
Right 1144416342 17:15050835-15050857 AGTGGGGTGGGGATGAGGGGAGG No data
1144416331_1144416341 -3 Left 1144416331 17:15050812-15050834 CCAATGTCAGGTACCTGGAGCTG No data
Right 1144416341 17:15050832-15050854 CTGAGTGGGGTGGGGATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144416331 Original CRISPR CAGCTCCAGGTACCTGACAT TGG (reversed) Intergenic
No off target data available for this crispr