ID: 1144416540

View in Genome Browser
Species Human (GRCh38)
Location 17:15052996-15053018
Sequence CTCCTCAGGAATGCTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144416540_1144416542 4 Left 1144416540 17:15052996-15053018 CCTCATTAAGCATTCCTGAGGAG No data
Right 1144416542 17:15053023-15053045 TCATCTCCAAGCAAGAGAGATGG No data
1144416540_1144416545 23 Left 1144416540 17:15052996-15053018 CCTCATTAAGCATTCCTGAGGAG No data
Right 1144416545 17:15053042-15053064 ATGGGCATTAAAAAGATTACTGG No data
1144416540_1144416543 5 Left 1144416540 17:15052996-15053018 CCTCATTAAGCATTCCTGAGGAG No data
Right 1144416543 17:15053024-15053046 CATCTCCAAGCAAGAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144416540 Original CRISPR CTCCTCAGGAATGCTTAATG AGG (reversed) Intergenic
No off target data available for this crispr