ID: 1144420016

View in Genome Browser
Species Human (GRCh38)
Location 17:15087961-15087983
Sequence CTCAAATAGCTGTCAGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144420012_1144420016 4 Left 1144420012 17:15087934-15087956 CCAGGGACCACTCTTCAAGCACC No data
Right 1144420016 17:15087961-15087983 CTCAAATAGCTGTCAGCATAGGG No data
1144420013_1144420016 -3 Left 1144420013 17:15087941-15087963 CCACTCTTCAAGCACCACTGCTC No data
Right 1144420016 17:15087961-15087983 CTCAAATAGCTGTCAGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144420016 Original CRISPR CTCAAATAGCTGTCAGCATA GGG Intergenic
No off target data available for this crispr