ID: 1144422767

View in Genome Browser
Species Human (GRCh38)
Location 17:15113130-15113152
Sequence CCTTACAAACTTCAAAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144422767_1144422770 -4 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422770 17:15113149-15113171 AAGGAATTTGAGAATCCAACTGG No data
1144422767_1144422777 21 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG No data
1144422767_1144422772 7 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422772 17:15113160-15113182 GAATCCAACTGGAGGTTCCGCGG No data
1144422767_1144422781 30 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422781 17:15113183-15113205 GGCCACAGTGAGGGCCCCAGGGG No data
1144422767_1144422774 9 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422774 17:15113162-15113184 ATCCAACTGGAGGTTCCGCGGGG No data
1144422767_1144422773 8 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422773 17:15113161-15113183 AATCCAACTGGAGGTTCCGCGGG No data
1144422767_1144422780 29 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422780 17:15113182-15113204 GGGCCACAGTGAGGGCCCCAGGG No data
1144422767_1144422771 -1 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422771 17:15113152-15113174 GAATTTGAGAATCCAACTGGAGG No data
1144422767_1144422779 28 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422779 17:15113181-15113203 GGGGCCACAGTGAGGGCCCCAGG No data
1144422767_1144422776 20 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422776 17:15113173-15113195 GGTTCCGCGGGGCCACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144422767 Original CRISPR CCTTACAAACTTCAAAGTCT GGG (reversed) Intergenic