ID: 1144422769

View in Genome Browser
Species Human (GRCh38)
Location 17:15113131-15113153
Sequence TCCTTACAAACTTCAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144422769_1144422776 19 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422776 17:15113173-15113195 GGTTCCGCGGGGCCACAGTGAGG No data
1144422769_1144422777 20 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG No data
1144422769_1144422771 -2 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422771 17:15113152-15113174 GAATTTGAGAATCCAACTGGAGG No data
1144422769_1144422773 7 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422773 17:15113161-15113183 AATCCAACTGGAGGTTCCGCGGG No data
1144422769_1144422774 8 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422774 17:15113162-15113184 ATCCAACTGGAGGTTCCGCGGGG No data
1144422769_1144422779 27 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422779 17:15113181-15113203 GGGGCCACAGTGAGGGCCCCAGG No data
1144422769_1144422780 28 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422780 17:15113182-15113204 GGGCCACAGTGAGGGCCCCAGGG No data
1144422769_1144422781 29 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422781 17:15113183-15113205 GGCCACAGTGAGGGCCCCAGGGG No data
1144422769_1144422770 -5 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422770 17:15113149-15113171 AAGGAATTTGAGAATCCAACTGG No data
1144422769_1144422772 6 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422772 17:15113160-15113182 GAATCCAACTGGAGGTTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144422769 Original CRISPR TCCTTACAAACTTCAAAGTC TGG (reversed) Intergenic