ID: 1144422777

View in Genome Browser
Species Human (GRCh38)
Location 17:15113174-15113196
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144422769_1144422777 20 Left 1144422769 17:15113131-15113153 CCAGACTTTGAAGTTTGTAAGGA No data
Right 1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG No data
1144422767_1144422777 21 Left 1144422767 17:15113130-15113152 CCCAGACTTTGAAGTTTGTAAGG No data
Right 1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144422777 Original CRISPR GTTCCGCGGGGCCACAGTGA GGG Intergenic