ID: 1144424220

View in Genome Browser
Species Human (GRCh38)
Location 17:15126146-15126168
Sequence CTCTTCTAATAGATGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424220_1144424222 28 Left 1144424220 17:15126146-15126168 CCAGCACACATCTATTAGAAGAG No data
Right 1144424222 17:15126197-15126219 GATTACACCCAATGCTGGTGAGG No data
1144424220_1144424221 23 Left 1144424220 17:15126146-15126168 CCAGCACACATCTATTAGAAGAG No data
Right 1144424221 17:15126192-15126214 ACAGTGATTACACCCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424220 Original CRISPR CTCTTCTAATAGATGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr