ID: 1144424610

View in Genome Browser
Species Human (GRCh38)
Location 17:15130164-15130186
Sequence CACCAGGCTTTGGCATCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424606_1144424610 -3 Left 1144424606 17:15130144-15130166 CCACTCCTGGGCTGATTTAACAC No data
Right 1144424610 17:15130164-15130186 CACCAGGCTTTGGCATCCAATGG No data
1144424608_1144424610 -8 Left 1144424608 17:15130149-15130171 CCTGGGCTGATTTAACACCAGGC No data
Right 1144424610 17:15130164-15130186 CACCAGGCTTTGGCATCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424610 Original CRISPR CACCAGGCTTTGGCATCCAA TGG Intergenic
No off target data available for this crispr