ID: 1144424856

View in Genome Browser
Species Human (GRCh38)
Location 17:15132285-15132307
Sequence GGGTGGGTCAATTCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424856_1144424864 10 Left 1144424856 17:15132285-15132307 CCTCAATTTGAATTGACCCACCC No data
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data
1144424856_1144424863 4 Left 1144424856 17:15132285-15132307 CCTCAATTTGAATTGACCCACCC No data
Right 1144424863 17:15132312-15132334 ATTTGCATGTAATTGAAAGTGGG 0: 26
1: 115
2: 189
3: 287
4: 465
1144424856_1144424862 3 Left 1144424856 17:15132285-15132307 CCTCAATTTGAATTGACCCACCC No data
Right 1144424862 17:15132311-15132333 AATTTGCATGTAATTGAAAGTGG 0: 22
1: 98
2: 205
3: 271
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424856 Original CRISPR GGGTGGGTCAATTCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr