ID: 1144424857

View in Genome Browser
Species Human (GRCh38)
Location 17:15132301-15132323
Sequence TTACATGCAAATTAAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 19, 1: 56, 2: 74, 3: 113, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424857_1144424864 -6 Left 1144424857 17:15132301-15132323 CCCACCCCTTAATTTGCATGTAA 0: 19
1: 56
2: 74
3: 113
4: 282
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data
1144424857_1144424865 26 Left 1144424857 17:15132301-15132323 CCCACCCCTTAATTTGCATGTAA 0: 19
1: 56
2: 74
3: 113
4: 282
Right 1144424865 17:15132350-15132372 ATGCAGTTGCCACAGTCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424857 Original CRISPR TTACATGCAAATTAAGGGGT GGG (reversed) Intergenic
901970638 1:12905067-12905089 TCACATGCAAATTCAAGGCTAGG - Intronic
901990846 1:13112636-13112658 TCACATGCAAATTCAAGGCTAGG - Intergenic
901991814 1:13121311-13121333 TCACATGCAAATTCAAGGCTAGG - Intergenic
902014527 1:13296703-13296725 TCACATGCAAATTCAAGGCTAGG + Intergenic
902028815 1:13405819-13405841 TCACATGCAAATTCAAGGTTAGG + Intergenic
902153403 1:14463089-14463111 TTACATGCAAATTAAGGGGTGGG + Intergenic
902260118 1:15218850-15218872 TCACATGCAAATTAAGGGGTGGG - Intronic
903794837 1:25920853-25920875 TTACATGCAAATTAAGGGGCAGG - Intergenic
904455990 1:30648449-30648471 TTATATGCAAATTAGGTGGCAGG + Intergenic
904668089 1:32139644-32139666 TCACAAGCAAATAAAAGGGTTGG + Intronic
905039029 1:34937939-34937961 TTATATGCAAATTAGGGGGCAGG - Intergenic
905127136 1:35723575-35723597 ATACATGTAAATGAATGGGTGGG - Intronic
905764940 1:40592515-40592537 TTACACACAAATTCAGGGGTGGG - Intergenic
906086603 1:43140826-43140848 TTGCATGCAAGACAAGGGGTAGG - Intergenic
906425077 1:45704952-45704974 TTATGTGCAAATTAAGTGGTGGG - Intronic
906499875 1:46333836-46333858 TTAGATGCAAATTAAGAAGCAGG - Intergenic
907002293 1:50873677-50873699 TTACATGCAAATTAAGGCACAGG - Intronic
909051989 1:70777213-70777235 TTACATGCAAATTAAGGGGCAGG - Intergenic
909748847 1:79134028-79134050 TTATGTGCAAATTAAGGGGCGGG + Intergenic
910034563 1:82775770-82775792 TTACATGCAAATTAGGGGGTGGG - Intergenic
910035456 1:82782691-82782713 TTACATGCAAATTAGGGGGTGGG - Intergenic
910309793 1:85810364-85810386 TTATATGCTAAATAAGGGGCAGG - Intronic
912043833 1:105427845-105427867 TTACATGCAAAATCAGGGCTGGG + Intergenic
913658187 1:120981817-120981839 TTACATGCCAATTAAGAGGTAGG + Intergenic
913717422 1:121550870-121550892 TTATGTGCAAATTAAGGGGCAGG + Intergenic
914009543 1:143764886-143764908 TTACATGCCAATTAAGAGGTAGG + Intergenic
914450378 1:147786397-147786419 TTACATACAAATTAAGGGGCAGG + Intergenic
914522755 1:148433082-148433104 TTGCATGCCAATTAAGAGGTAGG + Intergenic
914648168 1:149673561-149673583 TTACATGCCAATTAAGAGGTAGG + Intergenic
914982356 1:152425934-152425956 TGACATGCTAATTAAGGGGTGGG - Intergenic
915132551 1:153705771-153705793 TTACATGCAAATTAAGAAGCGGG - Intergenic
915438983 1:155932301-155932323 TTAAATTAAAATTAAGGGGCTGG - Intronic
916208033 1:162334258-162334280 TTAAATGCAAATCATGGAGTTGG + Intronic
918056343 1:181024862-181024884 GCACATGTAAATTGAGGGGTAGG + Intergenic
918682434 1:187372075-187372097 TTACATGCAAATTGAGGAGTGGG - Intergenic
918682503 1:187372741-187372763 CTACATGCAAATTGTGGGGTGGG + Intergenic
920709785 1:208284417-208284439 TAACATGCAAATTAAGTGTTAGG + Intergenic
920777524 1:208954378-208954400 TTATATGCTAACTAAGGGGTGGG - Intergenic
921535978 1:216349716-216349738 TTATATGCTGAATAAGGGGTGGG - Intronic
921802409 1:219416621-219416643 ATCAATGCAAATTGAGGGGTGGG + Intergenic
922154861 1:223032922-223032944 TTATATGCTAAACAAGGGGTGGG - Intergenic
922811504 1:228417608-228417630 TTATATGCTAAATAAGGGGTGGG + Intergenic
922968603 1:229715309-229715331 GTTAATGCAAATTGAGGGGTGGG - Intergenic
922968608 1:229715331-229715353 TTATATGCAAATTAAGGGACAGG - Intergenic
924286944 1:242497082-242497104 TTACATGAAAGTTAAGACGTAGG - Intronic
1063063600 10:2585742-2585764 CAACATGCACATTTAGGGGTAGG + Intergenic
1063882076 10:10541503-10541525 TTACATGCTAAACAAAGGGTGGG + Intergenic
1063925781 10:10975930-10975952 TTACATGCAAATTAAGGGGTGGG + Intergenic
1063965934 10:11345810-11345832 TCACATGCAAATTGAGGGTTGGG + Intergenic
1063966824 10:11352497-11352519 TTACATGCAAATTAAAGGCCAGG + Intergenic
1064169796 10:13020246-13020268 TTTCACACAAATTCAGGGGTGGG + Intronic
1064461715 10:15541030-15541052 TTATATGCAACTTAAGGGGTGGG - Intronic
1064504962 10:16018723-16018745 TTACATGCAAATTAAGGGACTGG + Intergenic
1064689141 10:17895925-17895947 TTACATGCAAATGAAGGGGCAGG + Intronic
1064710905 10:18123437-18123459 TTACATGCAAATTAAGGAGTGGG - Intergenic
1065383104 10:25109662-25109684 TTACATGCTAAACAAGGGGTGGG + Intergenic
1066312058 10:34206676-34206698 CTACATGCAAATTAAGAGATGGG + Intronic
1066354949 10:34674301-34674323 ATTAATGCAAATTAAGGGGCAGG - Intronic
1068350570 10:55839571-55839593 TAACATGCAAATTTTGGGGGAGG - Intergenic
1068657271 10:59588569-59588591 TTACACACAAATTAAGGGGCAGG + Intergenic
1069265780 10:66455617-66455639 TTACATGCATGTTAAGGAGTGGG - Intronic
1071777425 10:88804767-88804789 TTTCATGCAAATTAAGGGGCAGG - Intronic
1071901089 10:90120475-90120497 TTACATAAAAATTAACAGGTGGG - Intergenic
1072517839 10:96203505-96203527 TTGCAGGCAAATTAAGGTTTGGG + Intronic
1073604000 10:104875148-104875170 TTCCATGCAAAGTAATGAGTAGG - Intronic
1073748085 10:106493005-106493027 TTATATGCTACATAAGGGGTGGG + Intergenic
1073793319 10:106961786-106961808 TAACTTGCAAATTATGGGGTGGG - Intronic
1073936121 10:108634390-108634412 TAACATGCTAATTAAGGGGTGGG + Intergenic
1075363625 10:121862914-121862936 TTGCATGCAAATTAAAGGGTGGG - Intronic
1075375257 10:121973800-121973822 TTACATGAAAATTTGGGGGTAGG - Intronic
1075602823 10:123783147-123783169 TTACATGCTAAATAAGGAGTGGG - Intronic
1076083913 10:127608106-127608128 TTACATGCTAATTAAGTGGAGGG + Intergenic
1076200557 10:128554425-128554447 TTACATGCAAGTTAAGGGGTGGG + Intergenic
1077983111 11:7321746-7321768 TTACATACAAATTAAAGGGCGGG + Intronic
1078074452 11:8145430-8145452 GAACATGCAAATTGAGGGGCTGG - Intronic
1078982573 11:16553351-16553373 TTATATGCAAATTAAGGGGCAGG + Intronic
1079662574 11:23058460-23058482 TTACATGTTAATTAAGGGGCAGG - Intergenic
1079844343 11:25445967-25445989 TGACAAGACAATTAAGGGGTGGG + Intergenic
1080463196 11:32473578-32473600 TTACATGCAAATTAAGGGGCAGG - Intergenic
1081004540 11:37718649-37718671 TTACATGCTAATTAAGAGACAGG + Intergenic
1082898511 11:58219546-58219568 TTTAATGCTAATTAAGGGGCTGG - Intergenic
1083914378 11:65730645-65730667 TGGTATGCTAATTAAGGGGTCGG - Intergenic
1084101071 11:66949874-66949896 TTACATAAAAATCCAGGGGTAGG + Intronic
1084731827 11:71078780-71078802 TTACATGCAAATTATGGGGCAGG - Intronic
1085865145 11:80282175-80282197 TTACATGTAGATTAAGGGGGTGG + Intergenic
1086048605 11:82562564-82562586 TTAATTTCAAAATAAGGGGTTGG + Intergenic
1086515945 11:87613450-87613472 TGACACGCAAATCAAGGGGCAGG - Intergenic
1088380195 11:109184352-109184374 TTACATGTAAATTAAGGGGTGGG + Intergenic
1088670142 11:112132632-112132654 TTATATGCTAAATAAGAGGTGGG + Intronic
1090240122 11:125175885-125175907 TTACATGCAAGTCACGGTGTAGG - Intronic
1091009421 11:131985071-131985093 TTTCAAGCAAATGAAGGGGGAGG - Intronic
1091092293 11:132783103-132783125 TAACATTCAAATTAAGAGTTTGG + Intronic
1091566066 12:1649090-1649112 TTACAAGCACACTAAGGTGTGGG - Intergenic
1092251421 12:6900170-6900192 TTACATGCAAATTAAAGAGTGGG - Intronic
1092856423 12:12678222-12678244 TTAGATGGAGATTAAAGGGTTGG - Intronic
1094581445 12:31737432-31737454 TTACATGCAAATCAAGGGGCAGG + Intergenic
1095391884 12:41716774-41716796 TTACATGGAACTTGTGGGGTAGG + Intergenic
1096007624 12:48185102-48185124 TTACCTGGAAATTAAGGAATTGG + Exonic
1096273196 12:50183224-50183246 TTACATGGCTACTAAGGGGTGGG + Intronic
1097580113 12:61444432-61444454 TTATATGCTAAATAAGGGGTGGG - Intergenic
1097906009 12:64920283-64920305 TTAAATACAAAATAAGGAGTCGG + Intergenic
1098729105 12:74010239-74010261 TTATATGCTAAACAAGGGGTGGG + Intergenic
1099476563 12:83114507-83114529 TTAAATGAAAATTTAGGGTTAGG - Intronic
1099562487 12:84195382-84195404 TTACATGCAAATAAAGGGGCAGG - Intergenic
1099754152 12:86820516-86820538 TTACAGGCAAATTATTAGGTTGG - Intronic
1099854308 12:88143850-88143872 TTATATGCTAAACAAGGGGTGGG + Intronic
1101397535 12:104361655-104361677 TTACATGCAAATTAAGAGGCAGG - Intergenic
1101734534 12:107453305-107453327 CAACATTCAAATTTAGGGGTTGG - Intronic
1101855572 12:108440065-108440087 TTATATGCTAAACAAGGGGTGGG - Intergenic
1102392409 12:112559935-112559957 CTATATGCTAAATAAGGGGTGGG - Intergenic
1103067748 12:117914013-117914035 TTACATGGCCAGTAAGGGGTGGG - Intronic
1103132158 12:118478793-118478815 TGATATGCTAAATAAGGGGTGGG + Intergenic
1103236183 12:119374730-119374752 TTATATGCTAAACAAGGGGTGGG + Intronic
1103265641 12:119627976-119627998 CTATATGTAAATTAAGGGGCAGG - Intronic
1103458405 12:121085368-121085390 TTATATGCCAATTAAGGGGTGGG - Intergenic
1103879005 12:124151677-124151699 TAACATGCAAATTAAGGGGCAGG + Intronic
1104434288 12:128743424-128743446 TTATGTGCAAATTAAGGGGAGGG - Intergenic
1104621119 12:130313548-130313570 TTACATGAAAATAAAGGGGCAGG - Intergenic
1104646529 12:130501627-130501649 TTACATGCAAATTAAGGGGCAGG - Intronic
1105796259 13:23856493-23856515 TTAAATGCAAATTAAGGGGTGGG + Intronic
1106806475 13:33313024-33313046 TTAAAAGCAAATTATGGGCTTGG - Intronic
1107197736 13:37673639-37673661 TTTTATGCAAATTATGAGGTTGG + Intronic
1107557343 13:41528366-41528388 TAATATGCTAATTAAGGGGCAGG - Intergenic
1108048452 13:46405739-46405761 TTATATGCAAATTAAGAGGTGGG - Intronic
1108107994 13:47033915-47033937 TTCCATGCAAGTTATGGGTTTGG - Intergenic
1108376816 13:49821743-49821765 GTTAATGCAAATTGAGGGGTGGG - Intergenic
1109256962 13:60095414-60095436 CTATATGCAAATTAGGGGGTGGG + Intronic
1109256967 13:60095436-60095458 GTCAATGTAAATTAAGGGGTGGG + Intronic
1111179603 13:84645787-84645809 ATCAATGCAAATTGAGGGGTGGG + Intergenic
1111663842 13:91243217-91243239 TTGCATGCAAATTAAGGGGTAGG + Intergenic
1112022132 13:95380702-95380724 CTATATGCAAATTAAGGAGTGGG + Intergenic
1112106311 13:96243698-96243720 TTACATGCAAATTAATAGTTTGG + Intronic
1112583572 13:100697151-100697173 TTACATGCAAAGTAAGGAGTGGG + Intergenic
1112591101 13:100763640-100763662 TTACGTGCAAATTAATGGGCAGG - Intergenic
1112600915 13:100855124-100855146 TTTCATGCAATTTAAGGGCAGGG + Intergenic
1112751484 13:102588313-102588335 TTGCATGCAAATTAAGGGGTGGG + Intergenic
1113283995 13:108826365-108826387 TCACATGCAAAATAATGAGTTGG + Intronic
1113862603 13:113499013-113499035 TTACATGCTAAGCAAGGGGTAGG + Intronic
1114850633 14:26378823-26378845 TTACATGCAAATTAAGGAACAGG + Intergenic
1116160635 14:41263336-41263358 TTACGTGCAAATTAAGAGTCAGG - Intergenic
1116259349 14:42602966-42602988 TTACATGCATATTAAAGGGCAGG + Intergenic
1116636367 14:47401381-47401403 TTACATGGGAAATAAGGGGAGGG + Intronic
1117096991 14:52309231-52309253 TCACATGCAAATGAAGGATTTGG + Intergenic
1118081728 14:62368907-62368929 AAACATGCCAAATAAGGGGTAGG - Intergenic
1120060366 14:79975595-79975617 TTATATGCAAATTATGGGACAGG + Intergenic
1120124016 14:80719222-80719244 TTACATGCAAATTAAGGGGCAGG - Intronic
1120327440 14:83049243-83049265 TTACATGCAAATTAAGACATGGG - Intergenic
1120813732 14:88831319-88831341 TTACATGCAAATTAAGGGGTGGG - Intronic
1121513997 14:94536849-94536871 TTTAGTGCAAATTGAGGGGTGGG + Intergenic
1121673503 14:95732393-95732415 TTATATGCTAAACAAGGGGTGGG + Intergenic
1122014179 14:98779572-98779594 TTACAGACAAATCAAGGAGTAGG - Intergenic
1202841611 14_GL000009v2_random:126198-126220 TGACATGCTAATTAAGGGGCGGG - Intergenic
1202910998 14_GL000194v1_random:116430-116452 TGACATGCTAATTAAGGGGCGGG - Intergenic
1202881622 14_KI270722v1_random:66230-66252 TGGCATGCTAATTAAGGGGCGGG + Intergenic
1123822001 15:24040028-24040050 TTACATGCAAATTGAGGGGCAGG - Intergenic
1125618119 15:41034263-41034285 TTATAGGCACATTATGGGGTTGG + Intronic
1125973434 15:43930647-43930669 CTACATGCAAATTGAGAGCTGGG + Intronic
1127026480 15:54812994-54813016 TTAAATGGAAACTAAGGAGTGGG - Intergenic
1129714836 15:77840943-77840965 TCACCTGCAAAGTAAGTGGTAGG + Intergenic
1129981171 15:79872600-79872622 CTATATGTAAATTAAGGGGCAGG + Intronic
1130324527 15:82869021-82869043 TTACATGCAAATTAAGGGGCAGG - Intronic
1131192020 15:90324491-90324513 TTACATGCAAATTAAGGGATGGG + Intergenic
1131272542 15:90956013-90956035 ATAAATGCAAATAAAGGGTTTGG - Intronic
1133434874 16:5770480-5770502 TTATATGCTAAACAAGGGGTGGG - Intergenic
1133549301 16:6838477-6838499 TTGCATGCAAATTAAGGGGCAGG - Intronic
1133970456 16:10564089-10564111 GTATATGCAAATTAGGGAGTGGG + Intronic
1135794214 16:25425893-25425915 TTACATGCAAATTAAGAGATGGG - Intergenic
1135833158 16:25796800-25796822 TGACATGCTAATTAAGGGGCGGG + Intronic
1135904580 16:26499464-26499486 TTACATGCAAATTAAGGAAAGGG - Intergenic
1136177130 16:28524885-28524907 TCACATGCTAATTAAGAGGCGGG - Intergenic
1136358470 16:29762094-29762116 TCACATGCAAATTAAGGGGTGGG - Intergenic
1136614240 16:31386875-31386897 TTACATGCAAATTAAGGGGTGGG - Intergenic
1137846825 16:51698033-51698055 TTACATGAAAATTAAGGCATGGG + Intergenic
1137895658 16:52209081-52209103 TTATCTGTAAATTGAGGGGTGGG - Intergenic
1138777433 16:59740898-59740920 TTTTATGCAAATTAATGGGAAGG + Intronic
1138777438 16:59740920-59740942 GTTAATGCAAATTGAGGGGTGGG + Intronic
1138859287 16:60735924-60735946 TTGCATGCAAATTAAGGGGAAGG - Intergenic
1139681759 16:68570465-68570487 TTACATGCAAATCAAGGGGAGGG + Intronic
1139827982 16:69772615-69772637 TTATATGCAAGTTAAGGAGTGGG + Intronic
1140020855 16:71237340-71237362 TTATATGCAAATTAAGGGCCAGG + Intergenic
1140300586 16:73753492-73753514 TTACATGAAAATTAAGGAGTGGG - Intergenic
1142158016 16:88541539-88541561 TTACATGCAAATTAAAGGGTGGG + Intergenic
1143806745 17:9434808-9434830 TTGCATGCAAATGAAGAGGTGGG + Intronic
1144424857 17:15132301-15132323 TTACATGCAAATTAAGGGGTGGG - Intergenic
1145906736 17:28520515-28520537 CTTAATGCAAATTAAGGGGTGGG + Intronic
1146087969 17:29847870-29847892 GTTAATGCAAATTGAGGGGTGGG - Intronic
1146087974 17:29847892-29847914 TTACATGTAAATTAAGGGGCAGG - Intronic
1148293381 17:46477017-46477039 TTTCAAGCATATCAAGGGGTAGG + Intergenic
1148315566 17:46694720-46694742 TTTCAAGCATATCAAGGGGTAGG + Intronic
1148583879 17:48762920-48762942 TTTCCTGCAAGTTAAGAGGTAGG + Exonic
1151013137 17:70525051-70525073 TTACATGCAAATTAAGGGGCAGG - Intergenic
1151052049 17:70989430-70989452 TTATATGCTAAACAAGGGGTGGG + Intergenic
1151200624 17:72465255-72465277 TTTCATGCAAATCATGGGTTTGG + Intergenic
1151905466 17:77045627-77045649 TCACATGTCAGTTAAGGGGTTGG - Intergenic
1152009611 17:77703904-77703926 TTACATGCAAATTAAGGGGTGGG + Intergenic
1152292262 17:79446670-79446692 TTGCATGCAAATTAAGAGACAGG - Intronic
1152415842 17:80161246-80161268 TTATATGCTAATCAAGGGGTGGG + Intergenic
1152736049 17:81997286-81997308 CTACATGCACGTTAAGGGGTGGG + Intronic
1152803575 17:82343773-82343795 CTACATGCAAATTAAGAGGTGGG - Intergenic
1152930391 17:83106355-83106377 TGACATGCTAATTAGGGGGCGGG + Intergenic
1153829631 18:8910649-8910671 TTATATGCTAAATAAGGGGTGGG - Intergenic
1155523940 18:26697545-26697567 TTACATGCAAATTAGGGGGTGGG + Intergenic
1155630137 18:27883428-27883450 GTGCATGCAAATGAAGGGGCAGG + Intergenic
1155870052 18:31016162-31016184 TTATATGCTAAATAAGGGGTGGG - Intronic
1156205291 18:34879479-34879501 TGACCTGCAAATAAAGGAGTAGG - Intronic
1156291185 18:35749784-35749806 TTATATGCTAAACAAGGGGTGGG + Intergenic
1157076302 18:44471401-44471423 TTACATGCAAATTAAGAGGTGGG - Intergenic
1157388926 18:47284767-47284789 TTATATGCTAAATAAGCGGTGGG + Intergenic
1159108473 18:64029296-64029318 TTACATGCAAATTAAGGAGTGGG + Intergenic
1159183558 18:64942527-64942549 TTACATGCAAATTAAAGAGTGGG + Intergenic
1159185966 18:64974701-64974723 TTACATGCAAATTAAGGGAAGGG - Intergenic
1159246993 18:65819248-65819270 TTACATGCAAATCGAGGAGTGGG - Intronic
1159310491 18:66701628-66701650 TTACATGCAAATTAAGGGGTGGG - Intergenic
1159503108 18:69298958-69298980 TTACATGCAAATTAATGGATGGG - Intergenic
1159907603 18:74110690-74110712 ATACATACAAATTAAGTGGAAGG + Intronic
1162219530 19:9164329-9164351 TTACATGCAAATTAAGGGGTGGG + Intergenic
1162279720 19:9685954-9685976 TTATATGCTAAATAAGGGGTGGG + Intergenic
1162663022 19:12185130-12185152 TTATATGCAAATTAAGTGGTGGG + Intronic
1164433632 19:28209362-28209384 TTCCATGCAAATTGAGGGGTGGG - Intergenic
1164561010 19:29292265-29292287 TGACATGCAAATTAAGGGGAGGG + Intergenic
1164612813 19:29644466-29644488 TTATATGCTAAACAAGGGGTGGG - Intergenic
1164863163 19:31579811-31579833 TCACATGAAAATTAAGGCTTTGG + Intergenic
1164974105 19:32558904-32558926 TTACATGCAAATTAAGGGGCAGG - Intergenic
1165134734 19:33660697-33660719 GTTAATGCAAATCAAGGGGTGGG - Intronic
1165280573 19:34793822-34793844 TTATATGCTAAATAAGAGGTGGG + Intergenic
1165881367 19:39046348-39046370 TTACATGCAAATTAGGGGGTGGG - Intergenic
1166652590 19:44585746-44585768 TTACATGCAAATTAAGGGGTAGG + Intergenic
1166957252 19:46472744-46472766 TGACGTGCTAATTAAGGGGTGGG + Intergenic
1167677894 19:50899697-50899719 TTACATGCAAATTAAGTAATGGG + Intergenic
1167692421 19:50994639-50994661 TTACATGCAAATTAAGGGGTGGG - Intergenic
1167975910 19:53225853-53225875 TTACATGCAAACTAAGGGGCAGG - Intergenic
1168130762 19:54317074-54317096 TTATATGCAAATTAAAGGTCAGG - Intergenic
1168601408 19:57721720-57721742 TTAAATGCATATTTACGGGTGGG + Intronic
1202657230 1_KI270708v1_random:35327-35349 TGGCATGCTAATTAAGGGGCGGG + Intergenic
928038985 2:27854622-27854644 TTATATGCTAATTAAGAGGCAGG - Intronic
928346568 2:30503038-30503060 TTACATGCAAATTAAGGGGCAGG + Intronic
928476977 2:31637547-31637569 TTATATACTAATTAAGGGGTGGG - Intergenic
928634213 2:33226616-33226638 TAATATGCTAATTAAGGGGCAGG + Intronic
929080295 2:38116019-38116041 TCACTTCCAAATTATGGGGTGGG - Intergenic
929828386 2:45328341-45328363 TTAGATGCTAAATAAGAGGTGGG + Intergenic
929987795 2:46753713-46753735 TTATATGCTAAACAAGGGGTGGG + Intronic
930863710 2:56102513-56102535 TTACAAGCAAATTTAGGGGTGGG - Intergenic
931965434 2:67528687-67528709 TTATATGCAAATTAAGGTGCAGG - Intergenic
932784273 2:74586259-74586281 TTAAATGTAAATTAAAAGGTGGG + Intronic
932811604 2:74831015-74831037 TAACATGCAAATTAAGGGGCAGG - Intergenic
933032842 2:77354036-77354058 TTACATGCAAATTAAGGGGTAGG + Intronic
933951578 2:87334923-87334945 TGACATGCTAATAAAGGAGTGGG - Intergenic
934129607 2:88935521-88935543 TGACGTGCTAATTAAGGAGTGGG + Intergenic
934134483 2:88982544-88982566 TGACATGCTAATAAAGGAGTGGG + Intergenic
934235823 2:90231236-90231258 TGACATGCTAATAAAGGAGTGGG - Intergenic
934719927 2:96566814-96566836 TTATATGCAAATTAAGGGGTGGG - Intergenic
935120317 2:100178411-100178433 TTATATGCAAATTAAGGGGTGGG - Intergenic
935240855 2:101176938-101176960 TTATATGCTAAATAAGGGCTGGG + Intronic
936459407 2:112701640-112701662 TTATATACAAATTAAGTGATGGG + Intergenic
936630717 2:114199987-114200009 TTATATGCAAATTAAGGAGTGGG + Intergenic
936637751 2:114278449-114278471 TAACATGCAAACAAAGGGGTGGG + Intergenic
937870941 2:126785681-126785703 TTACATGCATAATAAGGAATTGG + Intergenic
940660834 2:156543226-156543248 TTGAATGGAAATTGAGGGGTTGG + Intronic
940919573 2:159292169-159292191 TGACACACAAATTAAGGGGAAGG - Intergenic
942147890 2:173044146-173044168 TTACATGCTAACTAAGGAGCGGG + Intronic
942673142 2:178398591-178398613 TTGCCTGAAAATTATGGGGTAGG - Intronic
942846545 2:180432838-180432860 TGACATGCTAATTAAAGGGTGGG + Intergenic
943041086 2:182806089-182806111 GTAAATGAAAATTGAGGGGTTGG - Intergenic
944173902 2:196808278-196808300 ATATATGCAAATTAAGGGATGGG + Intronic
944630467 2:201618992-201619014 TATCATGCACATTAAAGGGTCGG - Exonic
944778629 2:202994897-202994919 TTACATGCAAATTAAGGGGCAGG + Intronic
946042674 2:216795952-216795974 TTACATGCCAATCATGGAGTAGG + Intergenic
946058844 2:216924312-216924334 TTATATGCAAACTAAGGGGCAGG - Intergenic
946462235 2:219878833-219878855 TTATATGCTAAACAAGGGGTGGG - Intergenic
946551427 2:220805703-220805725 TTATATGCTAAACAAGGGGTGGG - Intergenic
946695606 2:222355337-222355359 TAACATACAAATTTAGGGGGTGG + Intergenic
947342855 2:229158070-229158092 TTAAATGCAAATGTAAGGGTGGG - Intronic
948254758 2:236558287-236558309 TGACATGCTAATGAAGGGGCGGG + Intergenic
948529384 2:238594604-238594626 TTATATGCTAAATAAGGGGTGGG - Intergenic
948880531 2:240855066-240855088 TGACATGCAAATGAAGGGGCAGG + Intergenic
1169035416 20:2447167-2447189 TTACATGCAAATTAAGGGGCAGG - Intergenic
1169271039 20:4199606-4199628 CTACATGCAAATTAAGGGGGTGG + Intergenic
1169680850 20:8211541-8211563 TTACATTCAAATGAAGTTGTAGG + Intronic
1170121719 20:12919482-12919504 TGACATACAAATTAAGGGACAGG - Intergenic
1170168390 20:13384581-13384603 TTGAATGCAAATTAAGTGCTGGG + Intergenic
1170470068 20:16659963-16659985 TTACATGCTAAATAAGGGACAGG + Intergenic
1170953086 20:20954359-20954381 TTATGTGCTAAATAAGGGGTGGG + Intergenic
1171022191 20:21595841-21595863 TCACATGCTAATTAAGAGGTGGG + Intergenic
1171325010 20:24283444-24283466 CTACATGCAAATTAGGGGGCAGG + Intergenic
1172319620 20:33986193-33986215 TTACATGCAAATTAAGGGGCAGG - Intergenic
1172570707 20:35968150-35968172 TCACATGCAAATTAAGGGGCAGG + Intronic
1172570714 20:35968194-35968216 GTTAATGCAAATTAAGGAGTGGG + Intronic
1173287433 20:41686077-41686099 TTATTTGCTAAATAAGGGGTGGG - Intergenic
1173308099 20:41871164-41871186 GTCAATGCAAATTGAGGGGTGGG - Intergenic
1173466379 20:43285262-43285284 TTATACGCAAATTGAGGGGTGGG + Intergenic
1174140783 20:48412256-48412278 TTATATGCTAATTAAGGGGTGGG - Intergenic
1174431188 20:50470521-50470543 TTATATGCTAATGAAGGGGCGGG + Intergenic
1175292925 20:57890346-57890368 TTACGTGCAAATTAAGGAGCCGG + Intergenic
1175509621 20:59515054-59515076 TTACATGCAAAGTAAGGGGCGGG + Intergenic
1175569394 20:60007537-60007559 TTACATGCAAATTAAGCAGCAGG + Intronic
1176597101 21:8757667-8757689 TGGCATGCTAATTAAGGGGCAGG + Intergenic
1176630352 21:9131127-9131149 TGACATGCTAATTAAGGGGCGGG - Intergenic
1176642918 21:9323612-9323634 TGGCATGCTAATTAAGGGGCGGG + Intergenic
1178042336 21:28652997-28653019 GTTAATGCAAATTGAGGGGTGGG - Intergenic
1178042341 21:28653019-28653041 TTACATGCAAATTAAGGGGAGGG - Intergenic
1178796968 21:35753767-35753789 TTGCAGGGAAATTAAGGGGAAGG + Intronic
1179296889 21:40070801-40070823 ATGCAGGCAGATTAAGGGGTAGG - Intronic
1180370017 22:11975587-11975609 TGGCATGCTAATTAAGGGGCGGG - Intergenic
1180376236 22:12096534-12096556 TGGCATGCTAATTAAGGGGAGGG + Intergenic
1180421338 22:12817165-12817187 TGGCATGCTAATTAAGGGGCGGG - Intergenic
1180930188 22:19584943-19584965 TGCCATGCTAATTAAGGGGCAGG - Intergenic
1180935823 22:19624839-19624861 TTATATGCTAAACAAGGGGTGGG - Intergenic
1181299063 22:21866975-21866997 ATACTAGCAAATTGAGGGGTGGG + Intronic
1181593870 22:23901587-23901609 TTATATGCTAAATAAGGGGCAGG + Intergenic
1181754922 22:25017004-25017026 TTATATGCAAATTAAGGGGGTGG + Intronic
1181873834 22:25924504-25924526 TCTCATTCAAATTAAGGTGTGGG - Intronic
1182122119 22:27795001-27795023 GTACAAGAAAATAAAGGGGTGGG + Intronic
1182192177 22:28473542-28473564 TTATATGCAAATCAAGGGGTGGG - Intronic
1182709670 22:32312638-32312660 TTACGAGCAAACTCAGGGGTAGG - Intergenic
1182743792 22:32589007-32589029 TTACATGCAAATTAAGAGGCGGG - Intronic
1183336451 22:37250200-37250222 TCACATGCAAATTAAGGGGTGGG - Intergenic
1183356013 22:37359938-37359960 TCACATGCAAATTAAGGGGCAGG + Intergenic
1183676600 22:39302284-39302306 TTATATGCAAATGAAGGGGCGGG - Intergenic
1184167431 22:42738340-42738362 TTATATGCTAAACAAGGGGTTGG - Intergenic
1184434845 22:44464956-44464978 TTACATGCAAATTAAGGGTCAGG + Intergenic
949094936 3:74793-74815 TTATATGCTAAACAAGGGGTAGG + Intergenic
950402745 3:12782580-12782602 TTATATGCTAAATAAGGGGTGGG + Intergenic
950700437 3:14741838-14741860 TTACATATAGATTAAGTGGTGGG + Intronic
950705277 3:14775615-14775637 TTATATGCTAAATAAGGGGTGGG + Intergenic
950782223 3:15401844-15401866 TCATATGCTAAATAAGGGGTAGG - Intronic
951134326 3:19085714-19085736 TTAAAAGTAAATTAATGGGTTGG + Intergenic
951382276 3:21998180-21998202 TTATATGCTAAATAAGGGGTAGG - Intronic
951832882 3:26950092-26950114 TTACATGCAAATTAAGGGGTGGG + Intergenic
953870690 3:46625026-46625048 ATACATGCAATTTCAGGGGCTGG + Intronic
954049531 3:47962131-47962153 TTACATGCTAATTAAGAGGCAGG - Intronic
955897962 3:63720912-63720934 TTACATGAAAACTAAGTGGCAGG - Intergenic
956197591 3:66668801-66668823 TTACCTGCAAATTAAGGGACAGG - Intergenic
956489985 3:69760522-69760544 TTACATGCAAATCAAGGTACAGG + Intronic
957097162 3:75786956-75786978 TGGCATGCTAATTAAGGGGCGGG - Intergenic
957354921 3:79069593-79069615 TTAGATGAAATTTAAGTGGTAGG - Intronic
959171777 3:102852825-102852847 GTTGATGCAAATTAAGGGGTGGG + Intergenic
959876848 3:111393178-111393200 TTACATGCAAATTAAGGGACAGG - Intronic
960375211 3:116892517-116892539 TGACATGCATTTTAAGGGATAGG - Intronic
961527228 3:127512894-127512916 TTACATGCAAATTAAGGGGTGGG - Intergenic
961744937 3:129058676-129058698 TTACATGCAAATTCAGGGGCAGG - Intergenic
962065026 3:131970578-131970600 TTAAAGGCAATTTAAGGGGATGG + Intronic
963386772 3:144606388-144606410 TTATGTGCAAATTAAGGATTTGG + Intergenic
963565277 3:146921714-146921736 TTGTATGCTAATTAAGGGGCTGG - Intergenic
964197301 3:154079528-154079550 TTATGTGCAAATTAAGGGGCAGG + Intergenic
964785428 3:160391024-160391046 CTATATGCAAATTAAGAAGTGGG - Intronic
965192649 3:165551097-165551119 TCACATGCAAATGAAGAGGAAGG + Intergenic
965366636 3:167808747-167808769 TTATATGCAATTTCAAGGGTTGG - Intronic
965969882 3:174542037-174542059 TTCTGTGCAAATTAAGGGATGGG + Intronic
966957318 3:184896071-184896093 TCACATAGAAATTAAGGGTTTGG + Intronic
1202743967 3_GL000221v1_random:81401-81423 TGGCATGCTAATTAAGGGGCGGG - Intergenic
969497890 4:7536433-7536455 TTACATGTCAAGTAAGGAGTGGG + Intronic
970073213 4:12186848-12186870 TTGCATGCAAATTAAAGGGAAGG + Intergenic
971992402 4:33916240-33916262 TTAGATACAAATTAAGGAGGGGG - Intergenic
972659207 4:41098026-41098048 TTACATGGAAGTTAATGGGAGGG - Intronic
973148509 4:46859829-46859851 TTACATGCAAATTAAGGGGTGGG - Intronic
973149331 4:46867538-46867560 TTACACGCAAATTAAGGGTTGGG - Intronic
973235497 4:47898728-47898750 TTATATGCATTTTGAGGGGTGGG - Intronic
973360403 4:49159889-49159911 TGGCATGCTAATTAAGGGGCGGG + Intergenic
973399685 4:49628020-49628042 TGGCATGCTAATTAAGGGGAGGG - Intergenic
973842545 4:54876732-54876754 TTATGTGCAAATTAGGGGGCAGG + Intergenic
974000736 4:56508268-56508290 TTAGATGCAAATGAAGGGAATGG + Intronic
974795602 4:66745140-66745162 TTACATGAACATTAACTGGTAGG + Intergenic
974802495 4:66836291-66836313 TTACATTAAAAATAAGGGGATGG + Intergenic
975267376 4:72386564-72386586 TTACATTAAATTTAAGGGATGGG + Intronic
975369241 4:73565579-73565601 TTACATTCAAAATAAAGGGATGG - Intergenic
976491633 4:85677313-85677335 TTATATGCACATTCAGGGGTGGG + Intronic
977272009 4:94928548-94928570 TGTCATGCAAATTAAGTGGAAGG + Intronic
977825272 4:101523937-101523959 TCACATACAAATTAAGAGGTAGG - Intronic
980155439 4:129098737-129098759 TTATATGCTAAATAAGGGGTGGG + Intronic
981916530 4:150039912-150039934 TGACATGCTAATTATGGGGTGGG + Intergenic
982371893 4:154642731-154642753 TTACATGCAAATTAAGGAGTGGG - Intronic
983782483 4:171687985-171688007 TTTCATGCAAATTAAGGCAATGG - Intergenic
985334490 4:188877220-188877242 TTACATGAAAATGAAGGCGAGGG - Intergenic
1202757835 4_GL000008v2_random:81974-81996 TGGCATGCTAATTAAGGGGAGGG + Intergenic
985700462 5:1368834-1368856 GTCAATGCAAATTAAGGGGCAGG - Intergenic
985700466 5:1368856-1368878 TTACGTGCAACTTAAGGGACAGG - Intergenic
985701429 5:1375481-1375503 ATCAATGCAAATTGAGGGGTGGG - Intergenic
986100192 5:4601101-4601123 TTACAGTAAAATTAATGGGTTGG + Intergenic
986111098 5:4718652-4718674 CTACATGCAAATTAAGGGTCAGG + Intergenic
986209496 5:5657361-5657383 CTACATGCAATTTAAGGGTGGGG - Intergenic
986929858 5:12804915-12804937 TTACAGGCAAAGGATGGGGTGGG - Intergenic
987371381 5:17196382-17196404 ATACATGGGAAGTAAGGGGTGGG + Intronic
987511924 5:18850420-18850442 TTAGATGCTAAATAAGGGGATGG - Intergenic
988087172 5:26487124-26487146 TTACATGCTAAACAAGGAGTGGG + Intergenic
989311328 5:40022127-40022149 GTCAATGCAAATTTAGGGGTGGG + Intergenic
989641128 5:43584437-43584459 TTATATGCTAAATAAGGGGCAGG - Intergenic
989641916 5:43590854-43590876 TTATATGCTAAATAAGGGGTGGG - Intergenic
993209997 5:84936788-84936810 TTACATGTAAATGTAGGTGTTGG + Intergenic
993548272 5:89240612-89240634 TTACATGGAGAAAAAGGGGTAGG + Intergenic
994730185 5:103482541-103482563 TTAAATGAAAATAAAGGGCTAGG + Intergenic
995607595 5:113873908-113873930 TTGCATGTAAAGTAAGGAGTCGG + Intergenic
995963387 5:117873100-117873122 TTATATGCTAATTAAGGGGCAGG + Intergenic
997065369 5:130553527-130553549 TTGCATGCAAATTAAAAGGTGGG - Intergenic
997065443 5:130554180-130554202 GTCAATGCAAATTGAGGGGTAGG - Intergenic
997065447 5:130554202-130554224 TTACAGGCAAATTAAGGGGTGGG - Intergenic
998517272 5:142768025-142768047 TTATATGCTAATTAAGAGGTGGG + Intergenic
999674693 5:153987300-153987322 TTACCTGCAAATTAAGGGGCAGG + Intergenic
1000460857 5:161516428-161516450 TTACATGCAAATTACATTGTTGG - Intronic
1000543561 5:162570500-162570522 TTACATGCAAATTAAGGGGAGGG - Intergenic
1001550700 5:172600485-172600507 ATACATGCAAATGATTGGGTAGG + Intergenic
1003510565 6:6776300-6776322 TTATATGCTAAATAAGGGGCAGG + Intergenic
1003746512 6:9008042-9008064 TTATATGCAAAGTGTGGGGTGGG - Intergenic
1008206917 6:48671550-48671572 TAACATGCAAATTAAGGAGCAGG + Intergenic
1008806971 6:55441371-55441393 TTACAAGGAAATGAAGAGGTGGG + Intronic
1009757018 6:67953246-67953268 TTACATGCAAATTAAGAGGCAGG - Intergenic
1010616606 6:78020582-78020604 TTACATGCAAATTAAGGGGCAGG - Intergenic
1010675914 6:78742768-78742790 TTGCATGCAAATTAAGGGGTGGG - Intergenic
1010866602 6:80983331-80983353 GTCAATGCAAATTGAGGGGTGGG - Intergenic
1010866607 6:80983353-80983375 TTACATATAAAGTAAGGGGAAGG - Intergenic
1010869438 6:81019991-81020013 TGACATGCAAATTAAATGGTAGG + Intergenic
1011178604 6:84593107-84593129 TTATATGCAAATTAAGGGGAAGG + Intergenic
1011545405 6:88477422-88477444 TTATATGTAAATTAAGGGGTGGG + Intergenic
1011824431 6:91289483-91289505 TTACGTGCTATTTAAGGTGTTGG + Intergenic
1013420677 6:109963887-109963909 TTACATGCAAAATAAGGGGCAGG - Intergenic
1013509370 6:110830547-110830569 TCACATGCAAATTAAGGGGCAGG - Intronic
1013523520 6:110954240-110954262 TTATATGCTAAACAAGGGGTGGG - Intergenic
1014397224 6:120939475-120939497 TTACATGCAACTGGAGGGATTGG + Intergenic
1016519574 6:144931448-144931470 TTACATGTGAATTAAGAGGCAGG + Intergenic
1016571943 6:145523283-145523305 TTACATGAAAATTCAAGGGGAGG + Intronic
1017053256 6:150413925-150413947 TTACATACAGATTAAGGGGCAGG + Intergenic
1018415619 6:163600014-163600036 TTACATGCAAATTAAGGAGCGGG - Intergenic
1018623256 6:165751796-165751818 GTGCATGCAAATTGAGGGGTGGG - Intronic
1018623261 6:165751818-165751840 TTACATGTAAATTAAGGGACAGG - Intronic
1019096010 6:169579709-169579731 TTATATGCTACATAAGGGGTGGG - Intronic
1019355752 7:577945-577967 TTATGTGCACATTAAGGGGTGGG + Intronic
1019887123 7:3915145-3915167 CTACATGCAAATGACGTGGTAGG + Intronic
1019954335 7:4401417-4401439 TTACCTGCAAATTAAGGGGTAGG + Intergenic
1020545114 7:9518217-9518239 TTACTTACAAATTAAGAGTTTGG - Intergenic
1020782039 7:12529936-12529958 CTACATGCAAATTAAGGGGTGGG + Intergenic
1020856787 7:13437098-13437120 TTACATACAAATCAAGAGGCAGG + Intergenic
1022149099 7:27580943-27580965 ATGCATGCAGGTTAAGGGGTAGG + Intronic
1022390658 7:29941192-29941214 TTACATGCAAAAAAAGGGACAGG + Intronic
1022543262 7:31159634-31159656 TTACATGCCAATTAAGATTTTGG - Intergenic
1023499094 7:40829197-40829219 TTATATGCTATTTAAGGAGTAGG - Intronic
1023769661 7:43544799-43544821 TTATATGTGAATTGAGGGGTTGG - Intronic
1024652692 7:51419175-51419197 TTAGATGCTAATTAAGGGGTGGG + Intergenic
1024747668 7:52427155-52427177 GTTAATGCAAATTGAGGGGTTGG - Intergenic
1024747672 7:52427177-52427199 TTACATGCAAATTAAAGGGTGGG - Intergenic
1025037872 7:55609814-55609836 TTAGATGCTAATTAAGGGGTGGG + Intergenic
1026076808 7:67179151-67179173 TTACATGCAAATTAAGGGGCAGG + Intronic
1026357314 7:69569876-69569898 TTACATGCAAATTAAGGAACAGG + Intergenic
1026535108 7:71232750-71232772 TTACACGCAAATTAAGGGGTGGG + Intronic
1026674299 7:72416246-72416268 TTATATGCAAATTAAGGAGCAGG - Intronic
1026679328 7:72453359-72453381 TTACATGCAAATTAAGGGGCAGG + Intergenic
1026700054 7:72633188-72633210 TTACATGCAAATTAAGGGGCAGG - Intronic
1027529853 7:79316755-79316777 TTAAGTGCAAATTATGTGGTGGG + Intronic
1027797196 7:82710514-82710536 TTACATGCAAATTAAGGTGCTGG + Intergenic
1028199422 7:87943766-87943788 TAACAAGCATATTTAGGGGTAGG - Intronic
1028317907 7:89427049-89427071 TTATGTGCAAATTAATGGGTGGG + Intergenic
1029576664 7:101407856-101407878 TCATATGCAAATTAAGGGGCGGG + Intronic
1030542584 7:110850433-110850455 TTATATGTAAATCAAGGGGCAGG - Intronic
1030690508 7:112527822-112527844 TTATATGCTAAATAAGGGGCAGG - Intergenic
1030790625 7:113723237-113723259 TTCTATGCCAATAAAGGGGTTGG - Intergenic
1031683019 7:124697688-124697710 TTACATCTAAATTAAAAGGTGGG - Intergenic
1032738534 7:134714714-134714736 TTAAATGCAAATTAAGGGATAGG + Intergenic
1033527283 7:142228784-142228806 TCACATGTAAATTAAGGAGCAGG + Intergenic
1033655454 7:143370682-143370704 TTATATGCTAAACAAGGGGTAGG - Intergenic
1033847181 7:145447946-145447968 TTACAGGCAAATTAAGGAGTGGG - Intergenic
1034091476 7:148368248-148368270 TTATCTGCAAGTTGAGGGGTGGG + Intronic
1035736591 8:1891759-1891781 TTATATGCCCACTAAGGGGTGGG - Intronic
1035813280 8:2511614-2511636 TTATATGCTAATTAAGGGGCGGG + Intergenic
1035976407 8:4316667-4316689 TCAAATGCAAACTAAGGGGGGGG + Intronic
1037983009 8:23268559-23268581 TTATATGCAAATCAAGGGGCAGG - Intergenic
1038375205 8:27033148-27033170 TTGCATGCAAATAAAGGGGTAGG + Intergenic
1038897878 8:31806823-31806845 TTACATGCACATTAATGGGTTGG - Intronic
1039324993 8:36475208-36475230 TTACATGCAAATTAAGGGGTAGG + Intergenic
1039725035 8:40206376-40206398 TTACATCCAAATTCGGGGGCAGG + Intergenic
1041014534 8:53579175-53579197 TTACATGCAAACTAAGTGGTGGG + Intergenic
1041073878 8:54151439-54151461 TTATATGCTAAACAAGGGGTGGG - Intergenic
1041806271 8:61853260-61853282 TCAAATGCAAATTAAAGGCTGGG - Intergenic
1041827786 8:62117461-62117483 ATGCCTGCACATTAAGGGGTTGG + Intergenic
1042518499 8:69684611-69684633 TTATATACAAAATAAGGGGCAGG - Intronic
1042746867 8:72118074-72118096 TTACATGCAAATTAAGGGATGGG - Intronic
1042761046 8:72271732-72271754 TTACATGCAAATTAGGGGGCAGG - Intergenic
1043118533 8:76290842-76290864 TTATATGCTAAATAAGGGGTGGG - Intergenic
1043754470 8:83985725-83985747 TTATATGCTAATTCAGGGGTGGG + Intergenic
1044137363 8:88604050-88604072 TTACATGCAAATTAAGGGGCAGG + Intergenic
1044155689 8:88843600-88843622 TTACATGCAAATTAAGTGGTGGG + Intergenic
1044155694 8:88843635-88843657 TCCAATGCAAATTGAGGGGTGGG + Intergenic
1044391305 8:91655087-91655109 TTACATTTAAATTAAAGGGCTGG - Intergenic
1044564810 8:93651541-93651563 TTACATGCAAATTAAGGGATGGG + Intergenic
1045428075 8:102087015-102087037 TTATATGCTAAGGAAGGGGTGGG - Intronic
1045573772 8:103396822-103396844 TTGCAAGCAACTTAGGGGGTGGG - Intergenic
1046947744 8:119990076-119990098 TAACATGCAGAACAAGGGGTAGG - Intronic
1047559574 8:125972214-125972236 TTCTATGCTAATTAAGGGGTGGG - Intergenic
1047942087 8:129836179-129836201 TTATATGCTAAATAAGGGGCAGG + Intergenic
1049015445 8:139916803-139916825 TTAAATACAAATCAAGGAGTCGG + Intronic
1049227276 8:141461532-141461554 TTATGTGCAAATTACGGGGTAGG - Intergenic
1049426097 8:142538549-142538571 TTCCCTGCAAATGCAGGGGTTGG - Intronic
1050620367 9:7445963-7445985 TTACATGCAAATTAAAAAGTGGG + Intergenic
1050991898 9:12166602-12166624 TTACATGCAAAGTAAGGAGCAGG + Intergenic
1051009498 9:12394150-12394172 TTTAATGCAAATTAAGAGGAAGG + Intergenic
1052332148 9:27281124-27281146 TTGCATGCTAATCAAGGGGCGGG - Intergenic
1055079492 9:72255210-72255232 TTACATGCAAATTAACGGGTGGG + Intronic
1056442124 9:86631854-86631876 TTTCATGCAAATTAGGGGTGAGG - Intergenic
1056618666 9:88191451-88191473 ATTAATGCAAATTAAGGGGCAGG + Intergenic
1056919042 9:90769941-90769963 TTACATGCAAATTAAGGGGTGGG + Intergenic
1057780916 9:98049436-98049458 TTATATGCTAAAGAAGGGGTGGG + Intergenic
1058193731 9:101950077-101950099 TGTCATGCTAACTAAGGGGTGGG - Intergenic
1058194587 9:101956907-101956929 TGACATGCTAATTAAGGGGCGGG - Intergenic
1058310617 9:103497040-103497062 CTGCATGCAAATTAAGGGTCAGG + Intergenic
1060486078 9:124047091-124047113 TTACATGATAGTTAAGGGGCAGG - Intergenic
1203689438 Un_GL000214v1:28982-29004 TGGCATGCTAATTAAGGGGCGGG + Intergenic
1203753185 Un_GL000218v1:98812-98834 TGACATGCTAATTAAGGGGCGGG - Intergenic
1203712599 Un_KI270742v1:111367-111389 TGGCATGCTAATTAAGGGGCGGG - Intergenic
1203538624 Un_KI270743v1:66838-66860 TGGCATGCTAATTAAGGGGAGGG + Intergenic
1203556193 Un_KI270743v1:209686-209708 TGGCATGCTAATTAAGGGGAGGG - Intergenic
1203646837 Un_KI270751v1:75071-75093 TGGCATGCTAATTAAGGGGCGGG - Intergenic
1185523529 X:759749-759771 TTACATGCAAATTAAGGGGCAGG - Intergenic
1185562868 X:1073054-1073076 TTACATGCAAATGAAGGGGCGGG - Intergenic
1185811613 X:3115568-3115590 TTGCATGCAGATTAAGGTGCGGG - Intergenic
1186015886 X:5192887-5192909 TTAAATGTAAAGTAAGGGTTGGG - Intergenic
1186089097 X:6024830-6024852 TTATATGCTAAGCAAGGGGTTGG - Intronic
1186224693 X:7386063-7386085 TTACATGAAAATCAACTGGTGGG + Intergenic
1187389087 X:18874098-18874120 TGACATGCAAATTAACGGGGCGG - Intergenic
1188187651 X:27134691-27134713 TTACATGCAAATTAAGGAGTGGG - Intergenic
1189650908 X:43188499-43188521 TTACATGCAAATTAAGGGGTGGG - Intergenic
1189894180 X:45636424-45636446 TTACAAGTAAATGAAGGGGTGGG - Intergenic
1190535650 X:51424429-51424451 TTACCTGCAAATGAAGGGGCAGG + Intergenic
1190554765 X:51623065-51623087 TTACCTGCAAATTAAGGGGCAGG + Intergenic
1190628395 X:52359924-52359946 GTTAATGCAAATTTAGGGGTGGG - Intergenic
1190628662 X:52363564-52363586 TTTAACGCAAATTGAGGGGTGGG - Intergenic
1190682072 X:52834982-52835004 TTCCATGTAAATGAAGGGGTAGG + Intergenic
1191142081 X:57125416-57125438 TTCAATGAAAAGTAAGGGGTTGG + Intergenic
1192314305 X:70040088-70040110 TTAAATTCAAATTAAAGTGTTGG - Intergenic
1192416820 X:70988502-70988524 TTACATGCAAATTAAGGGGTGGG + Intergenic
1194063622 X:89235268-89235290 TTACATGAAAATTAAGGTGTAGG - Intergenic
1194067163 X:89275992-89276014 TTACATGCAAATGAAGGGGTGGG + Intergenic
1195092035 X:101469919-101469941 TTATACGCAAATTAAGGGACAGG - Intronic
1195268836 X:103211357-103211379 TTACACACAAATTAGGGAGTGGG - Intergenic
1195373930 X:104207049-104207071 TTACATGCAAATTAAGGGGTGGG + Intergenic
1195389220 X:104343673-104343695 TTACATGCAAATTAAGGGGCAGG + Intergenic
1195446130 X:104955012-104955034 TTATATGCAAATTAGAGGGCAGG + Intronic
1197613637 X:128666883-128666905 TTGTATGCAAATTGAGGGTTAGG - Intergenic
1198271341 X:135059038-135059060 TTACATGCAAATTAAGGGACAGG - Intergenic
1198272691 X:135069199-135069221 TTGCATGCAAATTAAGGGGTGGG - Intergenic
1198846587 X:140918760-140918782 TTATATGCAAATTAAGGGGTGGG - Intergenic
1199407780 X:147483156-147483178 TTACATGCAAATTAAACAGTCGG - Intergenic
1200717796 Y:6569372-6569394 TTACATGAAAATTAAGGTGTAGG - Intergenic
1200721324 Y:6610201-6610223 TTACATGCAAATGAAGGGGTGGG + Intergenic
1201166829 Y:11216381-11216403 TGACATGCTAATTAAGGGGCGGG - Intergenic
1201269686 Y:12242741-12242763 TTGCATGCAGATTAAGGGGTAGG + Intergenic
1201328823 Y:12796676-12796698 TTATATGCAAAACAAGGGTTGGG + Intronic
1201636168 Y:16125582-16125604 TTACATTCTAAACAAGGGGTGGG + Intergenic