ID: 1144424858

View in Genome Browser
Species Human (GRCh38)
Location 17:15132302-15132324
Sequence ATTACATGCAAATTAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1130
Summary {0: 32, 1: 80, 2: 128, 3: 239, 4: 651}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424858_1144424864 -7 Left 1144424858 17:15132302-15132324 CCACCCCTTAATTTGCATGTAAT 0: 32
1: 80
2: 128
3: 239
4: 651
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data
1144424858_1144424865 25 Left 1144424858 17:15132302-15132324 CCACCCCTTAATTTGCATGTAAT 0: 32
1: 80
2: 128
3: 239
4: 651
Right 1144424865 17:15132350-15132372 ATGCAGTTGCCACAGTCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424858 Original CRISPR ATTACATGCAAATTAAGGGG TGG (reversed) Intergenic
900787848 1:4659954-4659976 ATTCCACGGAGATTAAGGGGCGG - Intronic
901552146 1:10003465-10003487 GTTACATGCAGAGTAAGGGGTGG - Intronic
901779190 1:11581749-11581771 ATTATATGCAGATTAAGGGGTGG - Intergenic
901974144 1:12930893-12930915 ATCACATGCCTATTAAGGGAGGG - Intronic
902011033 1:13270875-13270897 ATCACATGCCTATTAAGGGAGGG + Intergenic
902153402 1:14463088-14463110 ATTACATGCAAATTAAGGGGTGG + Intergenic
902260119 1:15218851-15218873 GTCACATGCAAATTAAGGGGTGG - Intronic
902264502 1:15252352-15252374 ACTGCATGCAGATTAAGGGCTGG + Intronic
902567291 1:17320470-17320492 ATTATATGCTAAACAAGGGGTGG + Intronic
902638817 1:17753054-17753076 ATTACATGGAGATTAAGCAGTGG - Intergenic
902749069 1:18494092-18494114 ATTACATGCAAATTATGGAGTGG + Intergenic
902966520 1:20008529-20008551 ACCACATGTAAATTAAGGGATGG + Intergenic
903207209 1:21791562-21791584 ATTATATGCTAAACAAGGGGTGG + Intergenic
903456370 1:23489936-23489958 ATTATATGCTAAACAAGGGGTGG + Intergenic
903602105 1:24550071-24550093 ATTGCATACAGATTAAGGGATGG - Intergenic
903824409 1:26132775-26132797 ATTATATGCAAATTAAGGGGTGG - Intergenic
904347648 1:29883730-29883752 ACTGCATGCAGATTAAGGGATGG - Intergenic
904348550 1:29890101-29890123 ATGACATGCAGATTAAGGGGAGG - Intergenic
905429896 1:37914178-37914200 ATTATATGCTAAACAAGGGGTGG - Intronic
905764941 1:40592516-40592538 ATTACACACAAATTCAGGGGTGG - Intergenic
906234413 1:44195887-44195909 ATTACATGCAAATTAAGGGGTGG - Intergenic
906261183 1:44391930-44391952 ATTATATGTAAATTAAGAAGAGG + Intergenic
906425078 1:45704953-45704975 ATTATGTGCAAATTAAGTGGTGG - Intronic
906473378 1:46149896-46149918 ATTATATGCTAAATAAGGAGTGG - Intronic
906578282 1:46910869-46910891 ATTGCATGCAGATTAAGGAGTGG + Intergenic
906978994 1:50608117-50608139 ATTACATGCAAATTAAGGGGTGG + Intronic
907026417 1:51124618-51124640 ATTACATGCAAATTAAGGAGTGG + Intronic
907542911 1:55232915-55232937 ATTATATGCTAAACAAGGGGTGG + Intergenic
908207560 1:61866875-61866897 ATTATATGCTAAATAAGGGGTGG + Intronic
908328121 1:63043858-63043880 ATTATATGCTAAATAAGGGGTGG - Intergenic
909748846 1:79134027-79134049 ATTATGTGCAAATTAAGGGGCGG + Intergenic
910034564 1:82775771-82775793 ATTACATGCAAATTAGGGGGTGG - Intergenic
910035457 1:82782692-82782714 ATTACATGCAAATTAGGGGGTGG - Intergenic
910051334 1:82977720-82977742 ATTATATGCTAAAAAAGGGGTGG + Intergenic
911732326 1:101304153-101304175 ATTACATGCAAATGAAGGGGTGG - Intergenic
912043832 1:105427844-105427866 ATTACATGCAAAATCAGGGCTGG + Intergenic
912388537 1:109285286-109285308 ATTATATGCTAAACAAGGGGTGG - Intergenic
912464766 1:109864290-109864312 ATTACATGCTAAATATGGGGTGG + Intergenic
913244420 1:116859357-116859379 ATGACATGCTAAACAAGGGGTGG - Intergenic
913576679 1:120182366-120182388 ATTATATGCCAAATAAGCGGTGG + Intergenic
913669250 1:121080307-121080329 ATTATATGCTAAACAAGGGGTGG + Intergenic
914021000 1:143867702-143867724 ATTATATGCTAAACAAGGGGTGG + Intergenic
914437456 1:147672307-147672329 ATTATATGCCAAACAAGGGGTGG - Intergenic
914558587 1:148793801-148793823 ATTATATGCCAAATAAGTGGTGG + Intergenic
914614248 1:149336429-149336451 ATTATATGCCAAATAAGTGGTGG - Intergenic
914938371 1:152000584-152000606 ATTGCATGCAGATTAAGGGGTGG + Intergenic
914982357 1:152425935-152425957 ATGACATGCTAATTAAGGGGTGG - Intergenic
915132552 1:153705772-153705794 ATTACATGCAAATTAAGAAGCGG - Intergenic
915211722 1:154314440-154314462 ATTACATGTTAAACAAGGGGTGG - Intergenic
915259310 1:154664938-154664960 ATTACATGCAAATTAAGGGGTGG - Intergenic
915710617 1:157894691-157894713 GTTATATGCAAATTAAGGGGGGG - Intronic
915710713 1:157895593-157895615 ATCACATGCAAATTAAGGGGCGG - Intronic
915712677 1:157916446-157916468 ATTACCTGGATATTAGGGGGAGG - Intergenic
916226626 1:162495620-162495642 ATTATATGCTAAACAAGGGGTGG + Intergenic
916241779 1:162647578-162647600 ATTATATGCTAAATAAGGAGTGG + Intronic
916637850 1:166693048-166693070 ATTATATGCTAAACAAGGGGTGG + Intergenic
916985158 1:170182984-170183006 ATTATATGCTAAATAAGGGGTGG - Intergenic
917071784 1:171159448-171159470 ATTACATGTTAAACAAGGGGTGG - Intronic
917205499 1:172566666-172566688 ATTATATGCAAATTAAGGGGTGG + Intronic
917613931 1:176717437-176717459 ATTATATGCTAATTAAGAGATGG - Intronic
917948699 1:180005409-180005431 ATTACATACAAAATATGAGGCGG - Intronic
918197167 1:182233401-182233423 ATTACCTGGAAATTAGGGGGTGG + Intergenic
918682435 1:187372076-187372098 ATTACATGCAAATTGAGGAGTGG - Intergenic
918682502 1:187372740-187372762 ACTACATGCAAATTGTGGGGTGG + Intergenic
919007854 1:191922776-191922798 ATGACATGCAAATTAAGACAAGG + Intergenic
919180587 1:194076292-194076314 ATTACATGCAGATTAATGGGTGG - Intergenic
919966492 1:202532037-202532059 ATTATATGCTAAACAAGGGGTGG + Intronic
920063424 1:203245856-203245878 ATTATATGCAAATTAAGGGGAGG + Intronic
920134564 1:203759161-203759183 ATTATATGCTAAACAAGGGGTGG - Intergenic
920606761 1:207396441-207396463 ATTATATGCAAATTAAAGGGTGG + Intergenic
920624147 1:207579642-207579664 GTTACATGTAAATTAAGGAGTGG - Intronic
920777525 1:208954379-208954401 ATTATATGCTAACTAAGGGGTGG - Intergenic
920824238 1:209410305-209410327 ATTATATGCTAAACAAGGGGTGG - Intergenic
920918561 1:210278812-210278834 ATTATATGCTAAACAAGGGGTGG - Intergenic
921053206 1:211525708-211525730 ATTATATGCTAAACAAGGGGTGG - Intergenic
921473971 1:215583239-215583261 ATTATATACTAAATAAGGGGTGG + Intronic
921535979 1:216349717-216349739 ATTATATGCTGAATAAGGGGTGG - Intronic
921690045 1:218138406-218138428 ATTACATGTAGATCAAGGGGTGG + Intergenic
921831314 1:219730847-219730869 ATTATATGCTAAACAAGGGGTGG - Intronic
922154862 1:223032923-223032945 ATTATATGCTAAACAAGGGGTGG - Intergenic
922159718 1:223070198-223070220 ATTATATGCTAAACAAGGGGTGG - Intergenic
922190878 1:223317337-223317359 ATTTTATGCTAAATAAGGGGTGG - Intronic
922237406 1:223732396-223732418 ATTATATGCTAAACAAGGGGTGG + Intronic
922811503 1:228417607-228417629 ATTATATGCTAAATAAGGGGTGG + Intergenic
922815081 1:228443088-228443110 ATTATATGCTAAATAAGGTGGGG - Intergenic
923644528 1:235804162-235804184 ATTAAATGCTAATTCAGGGATGG - Intronic
924273051 1:242354323-242354345 ATTATAGGAAAATTAAGGGGTGG - Intronic
924448634 1:244157823-244157845 ATTATATGCTAAACAAGGGGTGG + Intergenic
924496600 1:244596276-244596298 AATATATGCTAAATAAGGGGAGG - Intronic
924808097 1:247377716-247377738 ATTATATGCTAAACAAGGGGTGG + Intergenic
924848176 1:247794257-247794279 ATTACATGCAAATTAAGGTATGG - Intergenic
1063174230 10:3537187-3537209 ACTACAGGCAGATTAAGGGTAGG - Intergenic
1063472116 10:6296555-6296577 ATTATATGCTAAACAAGGGGTGG + Intergenic
1063751052 10:8947836-8947858 ATTATATGCTAAACAAGGGGTGG - Intergenic
1063751066 10:8947928-8947950 ATTATATGCTAAACAAGGGGTGG - Intergenic
1063882075 10:10541502-10541524 ATTACATGCTAAACAAAGGGTGG + Intergenic
1063925780 10:10975929-10975951 ATTACATGCAAATTAAGGGGTGG + Intergenic
1063965933 10:11345809-11345831 ATCACATGCAAATTGAGGGTTGG + Intergenic
1064461716 10:15541031-15541053 ATTATATGCAACTTAAGGGGTGG - Intronic
1064470228 10:15628167-15628189 ATTATATGCTAAACAAGGGGTGG - Intronic
1064710906 10:18123438-18123460 ATTACATGCAAATTAAGGAGTGG - Intergenic
1065383103 10:25109661-25109683 ATTACATGCTAAACAAGGGGTGG + Intergenic
1066265428 10:33772037-33772059 ATTATATGCTAAACAAGGGGTGG - Intergenic
1066312057 10:34206675-34206697 ACTACATGCAAATTAAGAGATGG + Intronic
1066711661 10:38242336-38242358 ATTATAGGAAAATTAAGGGGTGG + Intergenic
1066977143 10:42379349-42379371 ATTACATGCTAAACAGGGGGTGG + Intergenic
1068048351 10:51916422-51916444 ATTATATGCTAAGCAAGGGGTGG - Intronic
1068098370 10:52520725-52520747 ATTATATGCTAAACAAGGGGTGG - Intergenic
1068164017 10:53304581-53304603 ATTATATGCTAAACAAGGGGTGG + Intergenic
1068661076 10:59623921-59623943 ATCACATGCTAAACAAGGGGTGG + Intergenic
1068691509 10:59920455-59920477 ATTATATGCAAATTAAGGGGAGG + Intergenic
1069265781 10:66455618-66455640 ATTACATGCATGTTAAGGAGTGG - Intronic
1069329718 10:67277907-67277929 ATTATATGCCAAACAAGGGGTGG - Intronic
1069405456 10:68093852-68093874 ATTATATGCTAAACAAGGGGTGG + Intergenic
1070205325 10:74253289-74253311 ATAACATGCAGATTAAGGAGTGG + Intronic
1071013497 10:80967082-80967104 ATTACATGCTAAACAAGTGGTGG - Intergenic
1072214308 10:93274974-93274996 ATTATATGCTAAACAAGGGGTGG - Intergenic
1072509681 10:96107484-96107506 ATTATATGCTAAACAAGGGGTGG + Intergenic
1072887877 10:99296454-99296476 ATTGCATGTAGATTAAGGGGTGG - Intergenic
1072965627 10:99970290-99970312 AGTACATGCAAGTTAAGGATTGG + Intronic
1073351728 10:102824772-102824794 ATTATATGCAAATTAAGGGGTGG - Intergenic
1073355105 10:102847715-102847737 ATTATATGCAAATTAAGGGGTGG + Intergenic
1073748084 10:106493004-106493026 ATTATATGCTACATAAGGGGTGG + Intergenic
1073766328 10:106686666-106686688 ATTACTGGCAACTTAAGAGGAGG - Intronic
1073793320 10:106961787-106961809 ATAACTTGCAAATTATGGGGTGG - Intronic
1073936120 10:108634389-108634411 ATAACATGCTAATTAAGGGGTGG + Intergenic
1074287417 10:112111046-112111068 ATTACAGGCAACCTAAGGAGAGG - Intergenic
1075124578 10:119689489-119689511 ATTATATGCTAAACAAGGGGTGG - Intergenic
1075363626 10:121862915-121862937 ATTGCATGCAAATTAAAGGGTGG - Intronic
1075486575 10:122827329-122827351 ATTGCATGCAGATTAAGGGTTGG + Intergenic
1075602824 10:123783148-123783170 ATTACATGCTAAATAAGGAGTGG - Intronic
1076083912 10:127608105-127608127 ATTACATGCTAATTAAGTGGAGG + Intergenic
1076200556 10:128554424-128554446 GTTACATGCAAGTTAAGGGGTGG + Intergenic
1077084439 11:741683-741705 ATTATATGCTAAACAAGGGGTGG + Intergenic
1077983110 11:7321745-7321767 ATTACATACAAATTAAAGGGCGG + Intronic
1079235116 11:18682767-18682789 ATTATATGCTAAACAAGGGGTGG - Intergenic
1079281176 11:19088568-19088590 ATTATATGCTAAACAAGGGGTGG + Intergenic
1079333307 11:19550938-19550960 ATTATATGTAGATTACGGGGTGG - Intronic
1079699682 11:23529212-23529234 ATTCCATGCAAACTCTGGGGTGG - Intergenic
1079741478 11:24067324-24067346 ATTATATTCACATCAAGGGGTGG + Intergenic
1079789387 11:24717052-24717074 ATGACATGCATATTAAGAAGAGG + Intronic
1079947998 11:26767359-26767381 ATTATATGCTAAACAAGGGGTGG - Intergenic
1080058137 11:27928694-27928716 ATTGCATGCTAAACAAGGGGTGG + Intergenic
1080262699 11:30366712-30366734 ATTACATGAAAATAATAGGGAGG - Intergenic
1080463429 11:32475443-32475465 ATTACATGTAGATTAAGGGATGG + Intergenic
1080650284 11:34217029-34217051 ATTATATGCAAATTAAGGGGTGG - Intronic
1080806279 11:35656972-35656994 ATTATATGCTAAACAAGGGGTGG + Intergenic
1080934082 11:36843366-36843388 ATTTTAAGCAAATTCAGGGGTGG + Intergenic
1080996975 11:37615588-37615610 ATTACAACCTAATTAAGTGGGGG + Intergenic
1080999375 11:37649428-37649450 ATTACATCCAAATATAGGGGAGG - Intergenic
1081842710 11:46214892-46214914 ATTATATACAAATTAAGGGGTGG - Intergenic
1081970122 11:47192604-47192626 ATTATATGCTAAACAAGGGGTGG - Intergenic
1082992063 11:59215526-59215548 ATTATATGCTAAACAAGGGGTGG + Intergenic
1083001153 11:59292166-59292188 ATTATATGCTAAACAAGGGGTGG + Intergenic
1083025571 11:59547865-59547887 ATTATATGCTAAACAAGGGGTGG + Intergenic
1083483472 11:62965669-62965691 ATTATATGCTAAACAAGGGGTGG + Intronic
1083543489 11:63531448-63531470 ATTATATGCTAATTAAGAGACGG + Intergenic
1083700334 11:64473242-64473264 ATTGCATGCAAATTAAGGGGTGG - Intergenic
1083701815 11:64484409-64484431 ATTATATGCTAAACAAGGGGTGG + Intergenic
1084193638 11:67510719-67510741 ATGATATGCTAATCAAGGGGTGG + Intergenic
1084635705 11:70391049-70391071 ATGACATGCTAAACAAGGGGTGG + Intergenic
1084878914 11:72155587-72155609 ATTATATGCTAAAGAAGGGGTGG + Intergenic
1086453262 11:86937698-86937720 ATTATATGCTAAACAAGGGGTGG - Intronic
1086508493 11:87529801-87529823 ATTATATGCTAAACAAGGGGTGG - Intergenic
1086541288 11:87915621-87915643 ATTACATACTAAACAAGGGGTGG - Intergenic
1086978846 11:93170921-93170943 ATTTCATGTAGACTAAGGGGAGG + Intronic
1087310386 11:96535092-96535114 AATACATGCCATGTAAGGGGAGG - Intergenic
1087564430 11:99836082-99836104 ATTATATGCTAAACAAGGGGTGG + Intronic
1087645657 11:100805644-100805666 ATTATATGCTAAACAAGGGGTGG + Intronic
1087674214 11:101140316-101140338 ATTATATGCTAAACAAGGGGTGG + Intergenic
1088253486 11:107881575-107881597 ATTATATGCTAAACAAGGGGTGG + Intronic
1088380194 11:109184351-109184373 ATTACATGTAAATTAAGGGGTGG + Intergenic
1088566157 11:111175235-111175257 ATTACATGTAGATTAAGGGGTGG + Intergenic
1088670141 11:112132631-112132653 ATTATATGCTAAATAAGAGGTGG + Intronic
1088939421 11:114438698-114438720 ATTATATGCTAAACAAGGGGTGG - Intronic
1089486801 11:118852852-118852874 ATTATATGCTAAGCAAGGGGTGG + Intergenic
1089749598 11:120641464-120641486 ATTATATGCTAAGCAAGGGGTGG + Intronic
1089883492 11:121797144-121797166 ATTATATGCTAAACAAGGGGTGG - Intergenic
1090458878 11:126872311-126872333 TTTACATGCAAATTAAGAGGTGG - Intronic
1091069437 11:132549380-132549402 ATTATATGCTAAGCAAGGGGTGG - Intronic
1091410237 12:234374-234396 ATTATATGCTAAATAAGGGGCGG - Intronic
1091467089 12:694240-694262 ATTATATGCAAATTAAGGGGTGG - Intergenic
1092251422 12:6900171-6900193 ATTACATGCAAATTAAAGAGTGG - Intronic
1092782288 12:11998500-11998522 ATTATATGCTAAACAAGGGGTGG + Intergenic
1092853386 12:12650926-12650948 ATTATATGCTAAATAAGGGGTGG - Intergenic
1092943395 12:13431115-13431137 ATCAAAAGCAAATTAAGGGGAGG - Intergenic
1092947306 12:13468711-13468733 ATTACAGGAAAATTAAAAGGGGG - Intergenic
1093170431 12:15853702-15853724 ATTATATGCTAAACAAGGGGTGG + Intronic
1093390254 12:18610083-18610105 ATTACATGCCACTTAAGGTTGGG + Intronic
1093401826 12:18754867-18754889 ATTATATGCTAAACAAGGGGTGG - Intergenic
1093627825 12:21371087-21371109 ACTACATGCAGATTAAGGGATGG + Intronic
1093921242 12:24862086-24862108 ATTATATGCTAAGCAAGGGGTGG - Intronic
1094346792 12:29479187-29479209 ACTAAATGAAATTTAAGGGGTGG - Intronic
1094709483 12:32947054-32947076 ATTATATGCTAAACAAGGGGTGG - Intergenic
1094709790 12:32950087-32950109 ATTGTATGCAGATTAAGGGGTGG - Intergenic
1094715669 12:33012733-33012755 ATTATATGCTAAACAAGGGGTGG - Intergenic
1095478241 12:42608020-42608042 ATTACATGCTAAACAAGGGGTGG - Intergenic
1095479559 12:42621140-42621162 ATTATATGCTAAACAAGGGGAGG + Intergenic
1095517240 12:43020451-43020473 ATTATATGCTAAACAAGGGGTGG + Intergenic
1096017050 12:48286116-48286138 ATTACATGCAAATTAAGGGGTGG + Intergenic
1096664144 12:53151128-53151150 ATTACAAGTAGATTAAGGAGTGG + Intergenic
1096905695 12:54933334-54933356 ATTATATGCTAAGCAAGGGGTGG + Intergenic
1097116194 12:56699119-56699141 ATTATATGCTAAATAAGGGGTGG + Intergenic
1097331744 12:58339023-58339045 ATTATATGCTAAATTAGGGGTGG + Intergenic
1097338588 12:58412497-58412519 ATTATATGCCAAACAAGGGGTGG + Intergenic
1097580114 12:61444433-61444455 ATTATATGCTAAATAAGGGGTGG - Intergenic
1098137743 12:67420435-67420457 ATTATATGCTAAATAAAGGGTGG + Intergenic
1098316073 12:69194543-69194565 ATTATATGCTAAACAAGGGGTGG - Intergenic
1098437944 12:70488080-70488102 ATTATATGCTAAACAAGGGGTGG + Intergenic
1098640674 12:72835270-72835292 ATTATATGCTAAACAAGGGGTGG + Intergenic
1098689795 12:73472625-73472647 ATTACATGCAAATTAGGGTCAGG - Intergenic
1098729104 12:74010238-74010260 ATTATATGCTAAACAAGGGGTGG + Intergenic
1098898907 12:76092640-76092662 ATTATATGTAAATTAAGAGGTGG - Intergenic
1098938623 12:76508871-76508893 ATTATATGCTAAATAGGGGGTGG - Intronic
1099630631 12:85139082-85139104 ATTACTTCCAAAGTAAGGGGTGG + Intronic
1099854307 12:88143849-88143871 ATTATATGCTAAACAAGGGGTGG + Intronic
1099869761 12:88332089-88332111 ATTATATGCAAACTAACGGGAGG + Intergenic
1100010135 12:89942943-89942965 ATTCTATGCAAATTAAGGGATGG + Intergenic
1100312501 12:93409966-93409988 ATTAAATGCAAACAAAGAGGAGG + Exonic
1100448726 12:94685007-94685029 ATTATATGCTAAACAAGGGGTGG - Intergenic
1100829861 12:98508025-98508047 ATTATATGCTAAACAAGGGGTGG + Intergenic
1101620421 12:106381857-106381879 ATTATATGCTAAAGAAGGGGTGG + Intronic
1101796059 12:107975336-107975358 ATTATATGCAAATTAAGGGGTGG + Intergenic
1101857352 12:108455070-108455092 ATGATATGCTAATCAAGGGGTGG - Intergenic
1102273010 12:111555997-111556019 ATTCCATTCAAATAAAGGAGAGG + Intronic
1102392410 12:112559936-112559958 ACTATATGCTAAATAAGGGGTGG - Intergenic
1102410720 12:112715888-112715910 ATTATATGCTAAACAAGGGGTGG + Intronic
1102433965 12:112905794-112905816 AATACGTGCAAATTAAGGGCAGG + Intergenic
1102449744 12:113032522-113032544 ATTATATGAAAATTAAGGGGCGG - Intergenic
1102559789 12:113754125-113754147 TTTACATGCAAAAAAAGGAGAGG + Intergenic
1102666378 12:114577552-114577574 ATTACATGCAGATTAAGGAGTGG + Intergenic
1102883766 12:116506535-116506557 ATTGCATGCAGATTAAGGGGCGG - Intergenic
1103044282 12:117722634-117722656 ATTACATGCTAAACAAGGGGTGG - Intronic
1103067749 12:117914014-117914036 ATTACATGGCCAGTAAGGGGTGG - Intronic
1103132157 12:118478792-118478814 ATGATATGCTAAATAAGGGGTGG + Intergenic
1103163293 12:118749060-118749082 ATTATATGCTAAACAAGGGGTGG + Intergenic
1103236182 12:119374729-119374751 ATTATATGCTAAACAAGGGGTGG + Intronic
1103458406 12:121085369-121085391 ATTATATGCCAATTAAGGGGTGG - Intergenic
1104195614 12:126534519-126534541 ATTATATGCAAATTATGGAGTGG + Intergenic
1104233198 12:126905226-126905248 ATTACATGCTAAACAAGGAGTGG + Intergenic
1104434289 12:128743425-128743447 ATTATGTGCAAATTAAGGGGAGG - Intergenic
1104466640 12:128995730-128995752 ATTATATGCTAAATAAGGGGTGG + Intergenic
1104671516 12:130683804-130683826 ATTATATGCTAAACAAGGGGTGG - Intronic
1104756048 12:131269874-131269896 ATTACATGCAAATTAAGGAATGG + Intergenic
1105684531 13:22766039-22766061 ATTATATCCAAATTAGGGGAGGG - Intergenic
1105796258 13:23856492-23856514 TTTAAATGCAAATTAAGGGGTGG + Intronic
1106331784 13:28746105-28746127 AGTATATGCTAATCAAGGGGTGG + Intergenic
1106590987 13:31098451-31098473 ATTATATGCTAAATAAGGGGTGG - Intergenic
1106823545 13:33492686-33492708 ATTATATGCTAAACAAGGGGTGG - Intergenic
1107019982 13:35741385-35741407 ATTATATGCTAAACAAGGGGTGG + Intergenic
1107049168 13:36028975-36028997 ATTACATGCTAAACAAGGTGTGG - Intronic
1107602170 13:42024733-42024755 ATTGCATGTACATTAAGGGGTGG + Intergenic
1107666873 13:42699781-42699803 ATCACATGCTAAACAAGGGGTGG + Intergenic
1107932452 13:45317482-45317504 ATGACATGCTAAACAAGGGGTGG - Intergenic
1108048453 13:46405740-46405762 ATTATATGCAAATTAAGAGGTGG - Intronic
1108377717 13:49828852-49828874 AGTATATGCAAATTAAGGAAAGG - Intergenic
1108509215 13:51139773-51139795 ATTATATGGTAAATAAGGGGTGG - Intergenic
1109192978 13:59347119-59347141 ATTACATGTAAATTAAAGGGTGG + Intergenic
1109256961 13:60095413-60095435 GCTATATGCAAATTAGGGGGTGG + Intronic
1109346329 13:61118482-61118504 ATTATATGCTAAATAAGGGGTGG - Intergenic
1109419011 13:62085411-62085433 ATAACATGCAGATTAAGAGGCGG - Intergenic
1109551675 13:63910669-63910691 CTTATATGTAAATTAACGGGAGG + Intergenic
1109610429 13:64757988-64758010 ATTATATGCTAAACAAGGGGTGG + Intergenic
1109740274 13:66544635-66544657 ATTATATGCAAATTAAGGAGTGG + Intronic
1109800292 13:67368687-67368709 AATCCACGCAAATTAAGTGGTGG + Intergenic
1110046589 13:70840821-70840843 ATTACATGCTAAATAAGCAGTGG - Intergenic
1110264133 13:73519032-73519054 ATGACATGCTAAACAAGGGGTGG + Intergenic
1110287553 13:73767291-73767313 ATGACATGCAGATTAGGTGGTGG - Intronic
1110684654 13:78357918-78357940 ATGACATGCAAAGCAACGGGTGG - Intergenic
1111179598 13:84645764-84645786 GTTTCATGCAAATTAAGGGGTGG + Intergenic
1111208322 13:85041599-85041621 ATTACATGCAGATTAAGGGCTGG + Intergenic
1111266670 13:85824051-85824073 ATTATATGCTAATCAAGGGGTGG - Intergenic
1111431672 13:88153602-88153624 ATTGCATGCAGATTAAGTGGTGG + Intergenic
1111703079 13:91715032-91715054 ATTACATGCAGATTAAGGGGTGG + Intronic
1112022131 13:95380701-95380723 ACTATATGCAAATTAAGGAGTGG + Intergenic
1112583571 13:100697150-100697172 ATTACATGCAAAGTAAGGAGTGG + Intergenic
1112591381 13:100766438-100766460 ATTATATGCTAAACAAGGGGTGG + Intergenic
1112600914 13:100855123-100855145 GTTTCATGCAATTTAAGGGCAGG + Intergenic
1112659875 13:101495708-101495730 ATTAGAAGAAGATTAAGGGGGGG + Intronic
1112751483 13:102588312-102588334 ATTGCATGCAAATTAAGGGGTGG + Intergenic
1112838727 13:103549038-103549060 ATCATATGCTAAATAAGGGGTGG + Intergenic
1112903792 13:104392101-104392123 ATGATATGCTAATCAAGGGGTGG + Intergenic
1112974600 13:105301850-105301872 ATTACAGGCAAATAAAAGTGTGG + Intergenic
1113517980 13:110917696-110917718 ATTATATGCTAAACAAGGGGTGG - Intergenic
1113519068 13:110925492-110925514 ATTATATGCTAAACAAGGGGTGG - Intergenic
1113752199 13:112784178-112784200 ATTGCATGCAGATTAAGGGGTGG + Intronic
1115931215 14:38497487-38497509 ATCACAAGCAAATAAAGGGAAGG - Intergenic
1116558053 14:46338189-46338211 ATTACATGCAAATTGAGGGGTGG - Intergenic
1116636366 14:47401380-47401402 ATTACATGGGAAATAAGGGGAGG + Intronic
1116700744 14:48238256-48238278 ATTATATGCAAGTTAGGGTGCGG + Intergenic
1116897724 14:50333530-50333552 ATTATATGCTAAACAAGGGGTGG - Exonic
1117515819 14:56500161-56500183 ATTATATGCTAAACAAGGGGTGG + Intronic
1117680244 14:58196465-58196487 ATTATATGCTAAACAAGGGGTGG - Intronic
1118175627 14:63437247-63437269 ATTATATTCTAAATAAGGGGTGG - Intronic
1118273363 14:64363837-64363859 ATTATATGCTAAACAAGGGGTGG - Intergenic
1118304566 14:64645036-64645058 ATTACATGCTAAACAAGGGGTGG - Intergenic
1118374796 14:65167359-65167381 ATTGTATGCAAATTAAGGGGTGG - Intergenic
1118798972 14:69171872-69171894 ATTGCATGCAGATTAAGGGGCGG - Intergenic
1118869429 14:69728688-69728710 ATTATATGCCAAACAAGGGGTGG + Intronic
1118947752 14:70403662-70403684 ATTATATGCTAAACAAGGGGTGG - Intronic
1118949348 14:70419828-70419850 ATTATATGCTAAACAAGGGGTGG - Intergenic
1119102880 14:71896314-71896336 ATTATATGCTAAATAAGGGGTGG + Intergenic
1119109158 14:71955530-71955552 ATTATATGCTAAACAAGGGGTGG + Intronic
1119252643 14:73169943-73169965 ATTATATGCTAAACAAGGGGTGG + Intronic
1120229444 14:81827082-81827104 ATTACATGCTTAACAAGGGGTGG + Intergenic
1120327441 14:83049244-83049266 TTTACATGCAAATTAAGACATGG - Intergenic
1120550016 14:85858891-85858913 ATTATAGGCTAATTAGGGGGTGG - Intergenic
1120813733 14:88831320-88831342 ATTACATGCAAATTAAGGGGTGG - Intronic
1120821347 14:88914535-88914557 ACTACATGCAAAAAAGGGGGAGG + Intergenic
1120970192 14:90200610-90200632 ATTATATGCTAAACAAGGGGTGG + Intergenic
1120996990 14:90424567-90424589 ATTATATGCTAAACAAGGGGTGG + Intergenic
1121149438 14:91618082-91618104 ATAATATGCTAAATAAGGGGTGG + Intronic
1121666928 14:95679703-95679725 ATTATATGCTAAACAAGGGGTGG - Intergenic
1121673502 14:95732392-95732414 ATTATATGCTAAACAAGGGGTGG + Intergenic
1121705877 14:95993266-95993288 ATGACATGCTAAACAAGGGGTGG + Intergenic
1121836887 14:97100389-97100411 ATTACATGTAGATTAAGTGGTGG + Intergenic
1122551269 14:102551373-102551395 ATTATATGCAAAACAAGGGGTGG - Intergenic
1122796325 14:104207931-104207953 ATGGCATGCAGATTAAGGGGTGG - Intergenic
1122849456 14:104519632-104519654 ATTCCATGCAGGCTAAGGGGCGG + Intronic
1202841612 14_GL000009v2_random:126199-126221 ATGACATGCTAATTAAGGGGCGG - Intergenic
1202910999 14_GL000194v1_random:116431-116453 ATGACATGCTAATTAAGGGGCGG - Intergenic
1202881621 14_KI270722v1_random:66229-66251 ATGGCATGCTAATTAAGGGGCGG + Intergenic
1123815350 15:23972556-23972578 GTTACATGAAAATTGAGGGTTGG + Intergenic
1123829617 15:24121067-24121089 ATTACATGTAAATTGAGGAGTGG + Intergenic
1123844515 15:24284463-24284485 ATTACATGTAAATTGAGGAGTGG + Intergenic
1123859616 15:24450731-24450753 ATTACATGTAAATTGAGGGGTGG + Intergenic
1124016702 15:25883084-25883106 ATCACAGGCAAATCAAGGGGTGG - Intergenic
1124076987 15:26455574-26455596 ATTATATGCTAAACAAGGGGTGG + Intergenic
1124440519 15:29682418-29682440 ATGACATGCACATTAGGGGCAGG - Intergenic
1124989426 15:34656609-34656631 ATTATATGCTAAACAAGGGGTGG - Intergenic
1126152085 15:45532609-45532631 ATTATATGCTAAACAAGGGGTGG + Intergenic
1126158041 15:45583827-45583849 ATTATATGCGAAATAAGGGGTGG + Intergenic
1127026481 15:54812995-54813017 ATTAAATGGAAACTAAGGAGTGG - Intergenic
1127055165 15:55123958-55123980 ATTACATGCCAATTCAGGAGAGG + Intergenic
1127162463 15:56203798-56203820 ATGATATGCTAAATAAGGGGTGG - Intronic
1128301731 15:66570297-66570319 ATTAGGAGCAAATTGAGGGGTGG + Intergenic
1128342061 15:66829392-66829414 ATTATATGCTAAACAAGGGGTGG - Intergenic
1128465713 15:67909361-67909383 ATTATATGCTAAAAAAGGGGTGG - Intergenic
1128501826 15:68231901-68231923 ATTGCATGGAAATTTGGGGGAGG + Intronic
1128731271 15:70023136-70023158 ATTGCATGTAGATGAAGGGGTGG + Intergenic
1131113935 15:89782703-89782725 ATTATATGCTAAACAAGGGGTGG - Intergenic
1131192019 15:90324490-90324512 ATTACATGCAAATTAAGGGATGG + Intergenic
1132587568 16:712368-712390 ATTACATAAAAATTAAGGCCGGG - Intronic
1133091637 16:3408968-3408990 TTTACATGCAAGTAAGGGGGAGG - Exonic
1133307589 16:4820530-4820552 ATTAGGTGCAAACAAAGGGGAGG - Intronic
1133434875 16:5770481-5770503 ATTATATGCTAAACAAGGGGTGG - Intergenic
1133716739 16:8457474-8457496 ATTATATGCAAATTAAGGGGTGG - Intergenic
1133962396 16:10505884-10505906 ATTATATGCTAAACAAGGGGTGG - Intergenic
1133970455 16:10564088-10564110 AGTATATGCAAATTAGGGAGTGG + Intronic
1135056640 16:19237572-19237594 ATTACATGTAGATTAAAGGGTGG - Intronic
1135068505 16:19332079-19332101 ATTATATGCTAAATAAGGGGTGG - Intergenic
1135256478 16:20945389-20945411 ATTATATGCTAAACAAGGGGTGG - Intronic
1135355905 16:21768799-21768821 ATTATATGCAGATTCAAGGGTGG + Intergenic
1135416592 16:22273245-22273267 ATTGCATGCATATTAAGAGGCGG + Intronic
1135454395 16:22584938-22584960 ATTATATGCAGATTCAAGGGTGG + Intergenic
1135633242 16:24052521-24052543 ATTATATGCTAAAAAAGGGGTGG + Intronic
1135794215 16:25425894-25425916 ATTACATGCAAATTAAGAGATGG - Intergenic
1135833157 16:25796799-25796821 ATGACATGCTAATTAAGGGGCGG + Intronic
1135904581 16:26499465-26499487 ATTACATGCAAATTAAGGAAAGG - Intergenic
1135949307 16:26898376-26898398 ATTACATGCAAATTGAGGTATGG - Intergenic
1135980611 16:27143987-27144009 ATTAAATGCAAATTAAGGGGTGG + Intergenic
1136084195 16:27872884-27872906 ATTATATGCAAACCAAGGGGAGG - Intronic
1136177131 16:28524886-28524908 ATCACATGCTAATTAAGAGGCGG - Intergenic
1136358471 16:29762095-29762117 ATCACATGCAAATTAAGGGGTGG - Intergenic
1136558270 16:31021945-31021967 ATTATATGCTAAACAAGGGGTGG + Intergenic
1136614241 16:31386876-31386898 ATTACATGCAAATTAAGGGGTGG - Intergenic
1137276502 16:46937749-46937771 ATTACATGCTAGACAAGGGGTGG - Intergenic
1137357240 16:47778494-47778516 ATTATATGCAAATTAAGGGATGG + Intergenic
1137695402 16:50458473-50458495 ATTACATACTAAACAAGGGGTGG - Intergenic
1137846824 16:51698032-51698054 ATTACATGAAAATTAAGGCATGG + Intergenic
1137860611 16:51842699-51842721 AATACATGTAAATTTAGGGGAGG - Intergenic
1138248031 16:55481194-55481216 ATTATATGCTAAACAAGGGGTGG + Intronic
1138321124 16:56112881-56112903 ATTTTAAGCAAAATAAGGGGAGG + Intergenic
1138814323 16:60186821-60186843 ATTATACTCAAATTAAGGGGTGG - Intergenic
1138815970 16:60203035-60203057 ATTATATGCTAAACAAGGGGTGG - Intergenic
1138851658 16:60636549-60636571 ATTATATGCTAAACAAGGGGCGG - Intergenic
1138980307 16:62259684-62259706 ATTATATGCTAAGTAATGGGTGG - Intergenic
1139102466 16:63785256-63785278 ATGACATGCAAATTAAGGGGTGG + Intergenic
1139681758 16:68570464-68570486 ATTACATGCAAATCAAGGGGAGG + Intronic
1139827981 16:69772614-69772636 ATTATATGCAAGTTAAGGAGTGG + Intronic
1139854025 16:69966579-69966601 ATTATATGCTAAAGAAGGGGTGG - Intergenic
1139883008 16:70189492-70189514 ATTATATGCTAAAGAAGGGGTGG - Intergenic
1140016967 16:71196897-71196919 ATTATATGCTAAACAAGGGGTGG - Intronic
1140023704 16:71263839-71263861 ATCATATGCTAAATAAGGGGTGG - Intergenic
1140300587 16:73753493-73753515 ATTACATGAAAATTAAGGAGTGG - Intergenic
1140348670 16:74240496-74240518 ATTATAAACAAATTAAGGGCAGG + Intergenic
1140358042 16:74322533-74322555 ATTAAATGCTAAATATGGGGTGG - Intergenic
1140369501 16:74406027-74406049 ATTATATGCTAAAGAAGGGGTGG + Intergenic
1140499334 16:75419813-75419835 ATTATATGCTAAACAAGGGGTGG - Intronic
1140543275 16:75780107-75780129 ATTGCATGCAGATTAAGGGGTGG - Intergenic
1140666674 16:77234365-77234387 ATTACATGCTAAACATGGGGTGG - Intergenic
1140838750 16:78819495-78819517 ATTATATGCAAATTAAGTGGTGG - Intronic
1141108705 16:81254556-81254578 ATTATAAGAAAATTGAGGGGAGG - Intronic
1141410944 16:83832732-83832754 ATTACATGCAAATTAAAGGGAGG - Intergenic
1141847321 16:86619653-86619675 ATTGCATGCAGATGCAGGGGCGG - Intergenic
1142158015 16:88541538-88541560 ATTACATGCAAATTAAAGGGTGG + Intergenic
1142934677 17:3318479-3318501 ACAACAAGCAAATAAAGGGGAGG - Intergenic
1143806744 17:9434807-9434829 GTTGCATGCAAATGAAGAGGTGG + Intronic
1143888023 17:10080374-10080396 ATTATATGCCAAATAAGGGGTGG - Intronic
1143906282 17:10211781-10211803 ATTACATGCTAAACAAAGGGTGG + Intergenic
1144060041 17:11575149-11575171 ATTATATGCTAAACAAGGGGTGG - Intergenic
1144125272 17:12197197-12197219 GTTATATGCAAATTCAGGAGTGG - Intergenic
1144144326 17:12382498-12382520 GTTATATGCTAACTAAGGGGTGG + Intergenic
1144221278 17:13102037-13102059 ATTGCATGCAGATTAAGGAGTGG - Intergenic
1144281037 17:13726732-13726754 ATTATATGCTAAACAAGGGGTGG + Intergenic
1144303059 17:13941315-13941337 AGTCAATGCAAATTGAGGGGCGG + Intergenic
1144424858 17:15132302-15132324 ATTACATGCAAATTAAGGGGTGG - Intergenic
1144480584 17:15625867-15625889 ATTACATGCAAATTATGCACGGG - Intronic
1145226329 17:21131273-21131295 ATTATATGCTAAAGAAGGGGTGG + Intronic
1145830008 17:27908482-27908504 ATTATATGCTAAGCAAGGGGTGG - Intergenic
1145906735 17:28520514-28520536 CCTTAATGCAAATTAAGGGGTGG + Intronic
1146295045 17:31642888-31642910 ATTATATGCAAAACAAGGGGTGG - Intergenic
1146658315 17:34648356-34648378 ATTATATGCAAATTAAGGGCAGG + Intergenic
1147431640 17:40375028-40375050 GTTATATGCAAATTAAGGGGAGG + Intergenic
1147893630 17:43735627-43735649 ATTACATATGGATTAAGGGGTGG + Intergenic
1147901096 17:43785370-43785392 ATTACATGTAGATTAAGGGGCGG + Exonic
1148371425 17:47102552-47102574 ATTATATGCAAATTAAGGGGCGG - Intergenic
1148592315 17:48825548-48825570 ATTATATGCTAAACAAGGGGTGG + Intergenic
1149044013 17:52223587-52223609 ATTATATGCTAAACAAGGGGTGG + Intergenic
1149211997 17:54314678-54314700 ATTATATGCTAAACAAGGGGTGG + Intergenic
1149215092 17:54345302-54345324 ATTATATGCTAAATAAGGGGTGG - Intergenic
1149727905 17:58915236-58915258 ATTATATGCTAAACAAGGGGTGG + Intronic
1149753400 17:59167609-59167631 ATTATATGCTAAACAAGGGGTGG + Intronic
1149895784 17:60427243-60427265 ATTACTTGCAAATTATGGGGTGG + Intronic
1150062209 17:62078136-62078158 ATTACATGCAAATTAAAGGGTGG - Intergenic
1150511690 17:65759202-65759224 ATTACATGCTAAACAAGGGGTGG - Intronic
1150727551 17:67663708-67663730 ATTATATGCAAATTAAGGGGTGG + Intronic
1150957226 17:69872529-69872551 ATTATATGCTAAACAAGGGGTGG + Intergenic
1151014839 17:70542346-70542368 ATGACATGCTAAACAAGGGGTGG - Intergenic
1151052048 17:70989429-70989451 ATTATATGCTAAACAAGGGGTGG + Intergenic
1151241586 17:72762499-72762521 ATTATATGCTAAACAAGGGGTGG - Intronic
1151401669 17:73859732-73859754 ATTATATGCTAAACAAGGGGTGG - Intergenic
1151402061 17:73862232-73862254 ATTATATGCTAAACAAGGGGTGG + Intergenic
1151463730 17:74271361-74271383 ATTACATGCAAATTAAGAGGTGG + Intergenic
1152009610 17:77703903-77703925 ATTACATGCAAATTAAGGGGTGG + Intergenic
1152314926 17:79574607-79574629 ATTACATGCTAAACAAGGGGTGG - Intergenic
1152415841 17:80161245-80161267 ATTATATGCTAATCAAGGGGTGG + Intergenic
1152736048 17:81997285-81997307 ACTACATGCACGTTAAGGGGTGG + Intronic
1152803576 17:82343774-82343796 ACTACATGCAAATTAAGAGGTGG - Intergenic
1152930390 17:83106354-83106376 ATGACATGCTAATTAGGGGGCGG + Intergenic
1153829632 18:8910650-8910672 ATTATATGCTAAATAAGGGGTGG - Intergenic
1155523939 18:26697544-26697566 ATTACATGCAAATTAGGGGGTGG + Intergenic
1155870053 18:31016163-31016185 ATTATATGCTAAATAAGGGGTGG - Intronic
1156291184 18:35749783-35749805 ATTATATGCTAAACAAGGGGTGG + Intergenic
1156825650 18:41427452-41427474 ATTACCTGCAAATTAGGGGGTGG + Intergenic
1156988080 18:43372885-43372907 ATTACATGTATATTAAGGGGTGG - Intergenic
1157076303 18:44471402-44471424 ATTACATGCAAATTAAGAGGTGG - Intergenic
1157117271 18:44873691-44873713 ATTATTTGCAAATTAAAGTGGGG + Intronic
1157224052 18:45846829-45846851 ATTATATGCTAAACAAGGGGTGG + Intergenic
1157388925 18:47284766-47284788 ATTATATGCTAAATAAGCGGTGG + Intergenic
1157741094 18:50093932-50093954 ATTACATGCTAAACAAGGGGTGG - Intronic
1157746575 18:50141316-50141338 ATTACAGGTAAATTAAGGGGAGG - Intronic
1158569030 18:58580931-58580953 ATGATATGCTAAATAAGGGGTGG - Intronic
1158863450 18:61615509-61615531 ATTATATGCTAAACAAGGGGTGG - Intergenic
1159108472 18:64029295-64029317 ATTACATGCAAATTAAGGAGTGG + Intergenic
1159183557 18:64942526-64942548 TTTACATGCAAATTAAAGAGTGG + Intergenic
1159184448 18:64950429-64950451 CTTACATGCAAATTAAGTGTAGG + Intergenic
1159185967 18:64974702-64974724 ATTACATGCAAATTAAGGGAAGG - Intergenic
1159246994 18:65819249-65819271 ATTACATGCAAATCGAGGAGTGG - Intronic
1159253856 18:65919730-65919752 ATAACATGAAAATTATGGGCAGG + Intergenic
1159274751 18:66203307-66203329 CTTACATGGAAAAAAAGGGGGGG + Intergenic
1159310492 18:66701629-66701651 ATTACATGCAAATTAAGGGGTGG - Intergenic
1159437533 18:68438393-68438415 ATTATATGCTAAACAAGGGGTGG + Intergenic
1159503109 18:69298959-69298981 ATTACATGCAAATTAATGGATGG - Intergenic
1159653336 18:71003326-71003348 ATTGCATGCAGGTTAAGGGGTGG - Intergenic
1160341631 18:78094294-78094316 ACTGCATGCAAATTAAGGGGTGG + Intergenic
1161859987 19:6790769-6790791 ATTATATGCAAATCAAGGGGTGG + Intronic
1162219529 19:9164328-9164350 ATTACATGCAAATTAAGGGGTGG + Intergenic
1162279719 19:9685953-9685975 ATTATATGCTAAATAAGGGGTGG + Intergenic
1162663021 19:12185129-12185151 ATTATATGCAAATTAAGTGGTGG + Intronic
1162880437 19:13654821-13654843 ATTATGTGTAAATTAAGGGGTGG + Intergenic
1163211097 19:15840939-15840961 ATTATATGCTAACCAAGGGGTGG + Intergenic
1163512446 19:17743607-17743629 ATTATATGCAAATGAAGGCCAGG + Intergenic
1163568313 19:18065025-18065047 ATTATATGCAAATGAAGGGGCGG - Intronic
1163993922 19:21025216-21025238 ATTATATGCTAAACAAGGGGTGG + Intronic
1163999735 19:21086435-21086457 ATTATATGCTAAACAAGGGGTGG + Intronic
1164000136 19:21090833-21090855 ATTATATGCTAAACAAGGGGTGG + Intronic
1164006344 19:21153039-21153061 ATTATATGCTAAACAAGGGGTGG + Intronic
1164027384 19:21365070-21365092 ATTATATGCTAAACAAGGGGTGG + Intronic
1164433633 19:28209363-28209385 ATTCCATGCAAATTGAGGGGTGG - Intergenic
1164561009 19:29292264-29292286 ATGACATGCAAATTAAGGGGAGG + Intergenic
1164572511 19:29384744-29384766 ATTACATGCAGATTAAGGGGCGG + Intergenic
1164612814 19:29644467-29644489 ATTATATGCTAAACAAGGGGTGG - Intergenic
1164770702 19:30806595-30806617 ATTATATGCTAAACAAGGGGTGG - Intergenic
1165127122 19:33606201-33606223 ATGACATGCTAAACAAGGGGTGG - Intergenic
1165146065 19:33731277-33731299 ATTATATGCTAAACAAGGGGTGG + Intronic
1165187025 19:34031243-34031265 ATTATATGCAAATTGAGGGGTGG - Intergenic
1165187547 19:34035042-34035064 ATTATATGCTAAATAAAGGGTGG + Intergenic
1165278616 19:34776852-34776874 ATTACATGCAGATTAAGGGGCGG + Intergenic
1165280572 19:34793821-34793843 ATTATATGCTAAATAAGAGGTGG + Intergenic
1165285063 19:34834790-34834812 ATTGCATGCAGATTAAGGGGTGG - Intergenic
1165367346 19:35376376-35376398 ATTACATGCAGATTAAGGGGCGG - Intergenic
1165881368 19:39046349-39046371 GTTACATGCAAATTAGGGGGTGG - Intergenic
1165962482 19:39546936-39546958 ATTGCATGCAGAGTAAGGGACGG - Intergenic
1166321286 19:42020794-42020816 ATGACATGCTAAACAAGGGGTGG - Intronic
1166513338 19:43426223-43426245 ATTACATGCAAATTAAGGTGTGG - Intergenic
1166516148 19:43448493-43448515 ATTACATGTAGATTAAGGCGCGG - Intergenic
1166955285 19:46460131-46460153 ATTATATGCAAATTAAGGGGTGG + Intergenic
1166957251 19:46472743-46472765 ATGACGTGCTAATTAAGGGGTGG + Intergenic
1167480640 19:49728696-49728718 ATTATATGCTAAATAAGGGGTGG - Intergenic
1167677893 19:50899696-50899718 ATTACATGCAAATTAAGTAATGG + Intergenic
1167692422 19:50994640-50994662 ATTACATGCAAATTAAGGGGTGG - Intergenic
1167819168 19:51910336-51910358 ATTATATGCAAAGTAAGGGGTGG - Intronic
1168601407 19:57721719-57721741 ATTAAATGCATATTTACGGGTGG + Intronic
1168658682 19:58149221-58149243 ATTATATGCTAAACAAGGGGTGG - Intronic
1202657229 1_KI270708v1_random:35326-35348 ATGGCATGCTAATTAAGGGGCGG + Intergenic
925027107 2:618741-618763 ATTGCATGCAGATTAAGGGGTGG - Intergenic
925980060 2:9169396-9169418 ATTATATGCTAAACAAGGGGTGG + Intergenic
926115744 2:10212146-10212168 ATTACATGCAAATTAAGAGGTGG - Intergenic
926129808 2:10295738-10295760 ATTATATGCTAAACAAGGGGTGG + Intergenic
926144631 2:10389230-10389252 ATTACATGCAAATTAGGGGGTGG - Intronic
926340879 2:11903367-11903389 ATTGCATGCAGATTAAAGGGTGG - Intergenic
926564448 2:14454403-14454425 ATTACATGCAAATTAGGGGTGGG - Intergenic
927093820 2:19732616-19732638 TTTACATGCACATTATGGAGAGG - Intergenic
927408745 2:22801044-22801066 ATTATATGCTAAACAAGGGGTGG + Intergenic
927574886 2:24192642-24192664 ATGATATGCTAAATAAGGGGTGG + Intronic
927892583 2:26761486-26761508 ATTATATGCCAAACAAGGGGTGG - Intergenic
928476978 2:31637548-31637570 ATTATATACTAATTAAGGGGTGG - Intergenic
928700620 2:33895247-33895269 ATTATATGCTAAATAAGGGGTGG - Intergenic
928740584 2:34347631-34347653 ATTACAAGCAATTTGAGGGCAGG + Intergenic
929044616 2:37777657-37777679 ACTTCATGGAAATGAAGGGGTGG - Intergenic
929450553 2:42034147-42034169 ATTATATGCTAAAAAAGGGGTGG + Intergenic
929548512 2:42874039-42874061 ATTATATGCTAAACAAGGGGTGG + Intergenic
929694897 2:44106147-44106169 ATTATATGCTAAACAAGGGGTGG + Intergenic
929828385 2:45328340-45328362 ATTAGATGCTAAATAAGAGGTGG + Intergenic
929987794 2:46753712-46753734 ATTATATGCTAAACAAGGGGTGG + Intronic
930117144 2:47727872-47727894 ATTACATGCTAAATAAGTGGTGG + Intronic
930157396 2:48119425-48119447 ATTATATGCTAAATAAGGGGTGG - Intergenic
930369297 2:50483312-50483334 ATTATATGCTAAACAAGGGGTGG - Intronic
930414863 2:51078447-51078469 ATTATATGCTAAACAAGGGGAGG - Intergenic
930434469 2:51323084-51323106 ATTATATGCTAATAAAGGGGTGG + Intergenic
930673887 2:54179553-54179575 ATTATATGCTAAACAAGGGGTGG + Intronic
930863711 2:56102514-56102536 ATTACAAGCAAATTTAGGGGTGG - Intergenic
930891182 2:56389714-56389736 ATTGCATGCAGATTAAGAGGTGG + Intergenic
931859334 2:66337805-66337827 ATTATATGCTAAACAAGGGGTGG - Intergenic
932266085 2:70368014-70368036 ATTTCATCTAGATTAAGGGGTGG - Intergenic
932845708 2:75134093-75134115 GTTACATGCTAAATAAGGGGTGG - Intronic
932963665 2:76444977-76444999 ATTATATGCAAAGTAAGGAGTGG - Intergenic
933940815 2:87243649-87243671 ATTACATGCAAAGCAAGAGCTGG - Intergenic
933951579 2:87334924-87334946 ATGACATGCTAATAAAGGAGTGG - Intergenic
934129606 2:88935520-88935542 ATGACGTGCTAATTAAGGAGTGG + Intergenic
934134482 2:88982543-88982565 ATGACATGCTAATAAAGGAGTGG + Intergenic
934235824 2:90231237-90231259 ATGACATGCTAATAAAGGAGTGG - Intergenic
934719928 2:96566815-96566837 ATTATATGCAAATTAAGGGGTGG - Intergenic
935120318 2:100178412-100178434 ATTATATGCAAATTAAGGGGTGG - Intergenic
935240854 2:101176937-101176959 ATTATATGCTAAATAAGGGCTGG + Intronic
935472887 2:103480575-103480597 ATTATATGCTAAACAAGGGGTGG + Intergenic
935596875 2:104885702-104885724 ATTATATGCTAAACAAGGGGTGG - Intergenic
935637033 2:105257022-105257044 ATTACATGCTAAACAAGGGGTGG - Intergenic
935783995 2:106532581-106532603 ATTATATGCTAAACAAGGGGTGG + Intergenic
936344935 2:111668269-111668291 ATTACATGCAAATTAAGGGGAGG - Intergenic
936352324 2:111722363-111722385 ATTACATGCAAAGCAAGAGCTGG + Intergenic
936429646 2:112451106-112451128 ATTATATGCTAAACAAGGGGTGG + Intergenic
936617519 2:114063167-114063189 ATTACACGCTAAATATGGGGTGG + Intergenic
936630716 2:114199986-114200008 CTTATATGCAAATTAAGGAGTGG + Intergenic
936637750 2:114278448-114278470 ATAACATGCAAACAAAGGGGTGG + Intergenic
937712498 2:124994385-124994407 ATTATATGCTAAATAAGGGGTGG - Intergenic
938343570 2:130550681-130550703 ATTATATGCTAAACAAGGGGTGG + Intergenic
938346263 2:130570041-130570063 ATTATATGCTAAACAAGGGGTGG - Intergenic
938710766 2:133974492-133974514 ATTATATGCTAAATAAGGGGAGG + Intergenic
939286314 2:140135401-140135423 ATTATATGCTAAACAAGGGGTGG + Intergenic
939292230 2:140211498-140211520 ATTATATGCTAAACAAGGGGTGG + Intergenic
940122873 2:150287123-150287145 ATTATATGCAAATTAAAGGGTGG + Intergenic
940190757 2:151037742-151037764 ATTATATGCTAAACAAGGGGTGG - Intronic
940287088 2:152043131-152043153 ATTACATGCTGAACAAGGGGTGG - Intronic
940608623 2:155961692-155961714 ATTAAATACAGATTAAGGGCAGG - Intergenic
940654343 2:156470050-156470072 ATTATATGCTAAACAAGGGGTGG + Intronic
940662871 2:156569306-156569328 ATTATAAGAAAAATAAGGGGTGG + Intronic
940786119 2:157982703-157982725 ATTGAATGCAAATAAAGGGCTGG - Intronic
941304744 2:163849901-163849923 ATTACATGCTAAATAACAGGTGG + Intergenic
941584100 2:167335513-167335535 ATTATATGCTAAACAAGGGGTGG + Intergenic
941910891 2:170763662-170763684 CTTGCATGCAGATTAAGGGATGG + Intergenic
942062083 2:172236660-172236682 ATTATATGCTAAACAAGGGGTGG + Intergenic
942147889 2:173044145-173044167 GTTACATGCTAACTAAGGAGCGG + Intronic
942846544 2:180432837-180432859 ATGACATGCTAATTAAAGGGTGG + Intergenic
943077087 2:183208769-183208791 ATGATATGCCAAATAAGGGGTGG - Intergenic
943442905 2:187947968-187947990 ATTGCATGCAGATTCAGGGGTGG - Intergenic
943469328 2:188274392-188274414 ATTACATGCAGACTAAGAGGTGG - Intergenic
944173901 2:196808277-196808299 AATATATGCAAATTAAGGGATGG + Intronic
944199020 2:197085690-197085712 ATTATATGCTAAACAAGGGGTGG - Intronic
944834332 2:203563323-203563345 ATTACATGAAAAGTAGGGAGTGG + Intergenic
946444444 2:219726320-219726342 ATCATATGCTAAATAAGGGGTGG + Intergenic
946462044 2:219877419-219877441 ATTATATGCTAAACAAGGGGTGG - Intergenic
946462236 2:219878834-219878856 ATTATATGCTAAACAAGGGGTGG - Intergenic
946551428 2:220805704-220805726 ATTATATGCTAAACAAGGGGTGG - Intergenic
947097246 2:226580198-226580220 ATTATATGCTAAAAAAGGGGTGG + Intergenic
947805884 2:232967685-232967707 ATTACATGCAAATAAAATAGGGG + Intronic
947975837 2:234365030-234365052 ATTATATGCTAAATAAGGAGTGG - Intergenic
947984120 2:234434865-234434887 ATTATATGCTAAACAAGGGGTGG - Intergenic
948109593 2:235444048-235444070 ATTATATGCTAAACAAGGGGTGG - Intergenic
948254757 2:236558286-236558308 ATGACATGCTAATGAAGGGGCGG + Intergenic
948398187 2:237662948-237662970 ATTGCATGCAGATTAAGGAGCGG - Intronic
948529385 2:238594605-238594627 ATTATATGCTAAATAAGGGGTGG - Intergenic
1169522110 20:6385397-6385419 ATTACATGCTAAACAAGGGGTGG - Intergenic
1169565791 20:6852270-6852292 ATTATATGCTAAACAAGGGGTGG + Intergenic
1169718898 20:8650420-8650442 ATCACATGTAGATTAAGGGGTGG - Intronic
1170216992 20:13901979-13902001 ATTACATATAGATTAAGGGGTGG + Intronic
1170461573 20:16581647-16581669 ATTATATGCAAATTAAGGGGTGG + Intergenic
1170478787 20:16744431-16744453 GTCACATGCAAATTAAGGGGAGG + Intergenic
1170953085 20:20954358-20954380 ATTATGTGCTAAATAAGGGGTGG + Intergenic
1171022190 20:21595840-21595862 ATCACATGCTAATTAAGAGGTGG + Intergenic
1171171671 20:23020836-23020858 ATTATATGCTAAACAAGGGGTGG - Intergenic
1171306982 20:24115127-24115149 ATTATATGCTAAATAAGGGATGG - Intergenic
1171327570 20:24309049-24309071 ATTATATGCTAAACAAGGGGTGG - Intergenic
1171950671 20:31418591-31418613 ATTCCACGAAAATTAAGGGAAGG - Intergenic
1172035232 20:32005903-32005925 ATTATATGCTAAACAAGGGGTGG + Intergenic
1172362314 20:34321862-34321884 ATTATATGCTAAACAAGGGGTGG - Intergenic
1172367092 20:34358454-34358476 ATTATATGCTAAACAAGGGGTGG - Intergenic
1173284312 20:41656354-41656376 GTTACAGGCAAATAAAGAGGAGG + Intergenic
1173287434 20:41686078-41686100 ATTATTTGCTAAATAAGGGGTGG - Intergenic
1173466378 20:43285261-43285283 GTTATACGCAAATTGAGGGGTGG + Intergenic
1173486385 20:43444396-43444418 ATTACATGCAAATTAAGGGGTGG - Intergenic
1173891979 20:46519799-46519821 ATTACATGTAAATTAAGGAGTGG - Intergenic
1174140784 20:48412257-48412279 ATTATATGCTAATTAAGGGGTGG - Intergenic
1174431187 20:50470520-50470542 ATTATATGCTAATGAAGGGGCGG + Intergenic
1174516126 20:51093750-51093772 ATTATATGCTAAACAAGGGGTGG - Intergenic
1174894798 20:54436931-54436953 ATTGCATGCAGATTAAGGGGTGG + Intergenic
1174916695 20:54661045-54661067 ATTATATGCTAAACAAGGGGTGG + Intergenic
1175057077 20:56208401-56208423 ATTATATGCTAAACAAGGGGTGG - Intergenic
1175058214 20:56217507-56217529 ATTATATGCTAAACAAGGGGTGG - Intergenic
1175058617 20:56220912-56220934 ATTATATGCTAAACAAGGGGTGG - Intergenic
1175138252 20:56841034-56841056 ATTGCATGCAGATTAAGGGGTGG - Intergenic
1175509620 20:59515053-59515075 ATTACATGCAAAGTAAGGGGCGG + Intergenic
1176026670 20:62989486-62989508 ATTATATGCTAAGCAAGGGGTGG - Intergenic
1176630353 21:9131128-9131150 ATGACATGCTAATTAAGGGGCGG - Intergenic
1176642917 21:9323611-9323633 ATGGCATGCTAATTAAGGGGCGG + Intergenic
1177291524 21:19119576-19119598 ATTATATGCTAAATAAGGGGTGG - Intergenic
1177488122 21:21785456-21785478 ATGAAATGAAAATTATGGGGAGG - Intergenic
1177510093 21:22075493-22075515 ATTACATGCTAAACAAAGGGTGG - Intergenic
1177536494 21:22434572-22434594 ATTATATGCCAAGCAAGGGGTGG + Intergenic
1177557852 21:22715109-22715131 ATCACGTGCAAATTAAGGGGAGG - Intergenic
1178042342 21:28653020-28653042 ATTACATGCAAATTAAGGGGAGG - Intergenic
1178174721 21:30083412-30083434 TTTATATGCAAATTAATGGGTGG - Intergenic
1178420781 21:32441697-32441719 AATACATGCAAATATATGGGGGG + Intronic
1179321747 21:40298846-40298868 ATTAGAACCAAATTGAGGGGAGG - Intronic
1179414431 21:41186831-41186853 ACTATATGCAAATTAATGGGCGG + Intronic
1179427362 21:41292330-41292352 ATTATATGCAAATTAAAATGTGG + Intergenic
1179439594 21:41383649-41383671 ACCACAACCAAATTAAGGGGTGG + Intronic
1179477676 21:41658376-41658398 ATTGCATGCAGATTAAGGGTGGG + Intergenic
1179796016 21:43784105-43784127 ATGACATGCTAAACAAGGGGTGG + Intergenic
1180351941 22:11813014-11813036 ATGGTATGCTAATTAAGGGGCGG + Intergenic
1180370018 22:11975588-11975610 ATGGCATGCTAATTAAGGGGCGG - Intergenic
1180376235 22:12096533-12096555 ATGGCATGCTAATTAAGGGGAGG + Intergenic
1180386269 22:12179056-12179078 ATGGTATGCTAATTAAGGGGCGG - Intergenic
1180421339 22:12817166-12817188 ATGGCATGCTAATTAAGGGGCGG - Intergenic
1180931302 22:19593680-19593702 ATTACATGCAGATTAACGAGTGG - Intergenic
1180935824 22:19624840-19624862 ATTATATGCTAAACAAGGGGTGG - Intergenic
1181519956 22:23440478-23440500 ATTATATGCTAATGAAGGGGTGG - Intergenic
1181910019 22:26231200-26231222 ATTACATGCAAATTAAGGGGTGG + Intronic
1182192178 22:28473543-28473565 ATTATATGCAAATCAAGGGGTGG - Intronic
1182538387 22:31023387-31023409 ATTATATGCTAAACAAGGGGTGG + Intergenic
1182743793 22:32589008-32589030 ATTACATGCAAATTAAGAGGCGG - Intronic
1182965505 22:34517820-34517842 ATTATATGCTAAATAAGGGATGG - Intergenic
1183113277 22:35669033-35669055 ATTATATGCCAAACAAGGGGTGG - Intergenic
1183336452 22:37250201-37250223 GTCACATGCAAATTAAGGGGTGG - Intergenic
1183676601 22:39302285-39302307 ATTATATGCAAATGAAGGGGCGG - Intergenic
1184225080 22:43124968-43124990 ATTACATGCTAAACAAGGGGTGG + Intronic
1184612743 22:45615430-45615452 ATTATATGTACATTGAGGGGTGG + Intergenic
1185131899 22:49044030-49044052 ACTACATGCTAATTAGGGGTTGG + Intergenic
1185152254 22:49170708-49170730 ATTACATGCAGATTAAGGAGTGG + Intergenic
1185242916 22:49755997-49756019 ATTACATGCAAATTAAGGATGGG - Intergenic
949602367 3:5614004-5614026 ATTATAATCCAATTAAGGGGTGG - Intergenic
950040984 3:9919063-9919085 ATGACATGCAAATTCATGGAGGG - Intronic
950230080 3:11268803-11268825 ATTATATGCTAAACAAGGGGTGG + Intergenic
950402744 3:12782579-12782601 ATTATATGCTAAATAAGGGGTGG + Intergenic
950513975 3:13451947-13451969 AAGACATGCTAATTAAGAGGCGG - Intergenic
950700436 3:14741837-14741859 ATTACATATAGATTAAGTGGTGG + Intronic
950705276 3:14775614-14775636 ATTATATGCTAAATAAGGGGTGG + Intergenic
950782470 3:15403840-15403862 ATTATATGCTAAACAAGGGGTGG + Intronic
951417643 3:22444688-22444710 TGTACATGCAAATGAAGTGGAGG + Intergenic
951684062 3:25325088-25325110 ATTATATGCTAAACAAGGGGCGG + Intronic
951832881 3:26950091-26950113 ATTACATGCAAATTAAGGGGTGG + Intergenic
951923075 3:27877055-27877077 ATTATATGCTAAACAAGGGGTGG + Intergenic
952559082 3:34568627-34568649 ATTATATGCTAAATGAGGGGTGG + Intergenic
953638650 3:44685324-44685346 ATCGCATGCAGATTAAGGGGCGG - Intergenic
954483103 3:50820089-50820111 ATTATATGCTAAACAAGGGGTGG - Intronic
954803497 3:53201356-53201378 ATTATATGCAAATTAAGGGGTGG - Intergenic
955381171 3:58439570-58439592 ATTATATGCTAAACAAGGGGTGG + Intergenic
955710770 3:61776868-61776890 AATTAATTCAAATTAAGGGGTGG - Intronic
955781234 3:62486876-62486898 ATTACATGTAGATTAAGGAGAGG + Intronic
955803848 3:62713508-62713530 ATTACGTGCCAAATAAGGTGTGG - Intronic
955821078 3:62896120-62896142 ATTATACACAAATTAAGGTGTGG + Intergenic
956117250 3:65930928-65930950 ATTATATGCTAAACAAGGGGTGG - Intronic
956484906 3:69711737-69711759 ATTATATGCAAATTAAGATATGG - Intergenic
956839258 3:73121825-73121847 TTTATATGCAAACTAAGAGGTGG + Intergenic
956929016 3:74021439-74021461 AGTAAATGCAAATTACAGGGAGG - Intergenic
957097163 3:75786957-75786979 ATGGCATGCTAATTAAGGGGCGG - Intergenic
957218154 3:77348281-77348303 ATTATATGCTAAACAAGGGGTGG + Intronic
957539180 3:81546715-81546737 ATTATATGCTAAACAAGGGGTGG - Intronic
957893034 3:86384314-86384336 ATTATATGCTAAACAAGGGGTGG + Intergenic
958038365 3:88195988-88196010 ATTATATGCTAAACAAGGGGTGG + Intergenic
958890448 3:99776771-99776793 ATTATATGCTAAACAAGGGGTGG + Intronic
959171776 3:102852824-102852846 GGTTGATGCAAATTAAGGGGTGG + Intergenic
959333037 3:105030593-105030615 ATTATATGCAAATTAAGGGGTGG - Intergenic
959343201 3:105157603-105157625 ATTATATGCTAAACAAGGGGTGG + Intergenic
959458327 3:106591756-106591778 ATTATATGCAAATTAAGGGATGG - Intergenic
959741423 3:109724821-109724843 ATTGCATGGAAATTAAGGACAGG + Intergenic
959826030 3:110796803-110796825 ATTATATGCTAAATAAGGGGTGG - Intergenic
959872635 3:111346033-111346055 ATTATATGCTAAACAAGGGGTGG + Intronic
960040998 3:113149779-113149801 ATTATATGCTAAACAAGGGGTGG - Intergenic
960224691 3:115156116-115156138 ATTATATGCTAAACAAGGGGTGG + Intergenic
960504761 3:118479226-118479248 ATTACATGCTAAACAAGGGGTGG - Intergenic
960509457 3:118530992-118531014 ATTATATGCCAAACAAGGGGAGG + Intergenic
960858719 3:122129566-122129588 ATTACATGCAAATTAAGGGGTGG + Intergenic
961503576 3:127355290-127355312 ATTACATGCAAATTAAGGGGTGG + Intergenic
961527229 3:127512895-127512917 ATTACATGCAAATTAAGGGGTGG - Intergenic
962260948 3:133905550-133905572 ATTGCATGCAGATTAAGGGGTGG + Intergenic
963072205 3:141313432-141313454 ATTGCATGCAGATTAAGTGTTGG - Intergenic
963983095 3:151562311-151562333 ATGACATGCTAAACAAGGGGTGG - Intergenic
964918094 3:161860512-161860534 TAAATATGCAAATTAAGGGGGGG + Intergenic
965142711 3:164860671-164860693 ATGACATGCTAAACAAGGGGTGG - Intergenic
965258975 3:166455560-166455582 ATTACATGATAAACAAGGGGTGG + Intergenic
965706105 3:171509760-171509782 ATTACATGAAAAGTCAGGAGAGG + Intergenic
965969881 3:174542036-174542058 ATTCTGTGCAAATTAAGGGATGG + Intronic
966241522 3:177759506-177759528 ATTATATGCTAAACAAGGGGTGG - Intergenic
966705507 3:182909538-182909560 ATTTCATTCAAAGTAAGGAGAGG - Intronic
967243606 3:187465264-187465286 ATTACATGCTAAACAAGGTGTGG - Intergenic
967475978 3:189919602-189919624 GGTACATGCACATTAAGGGTTGG - Intergenic
967567663 3:190990980-190991002 ATTGCAAGCATATTAAGGTGTGG + Intergenic
967620494 3:191627933-191627955 ATTACATACAAATTAAGGGGTGG - Intergenic
967843610 3:194027274-194027296 ACTATATGCAAATTAAGGGGCGG + Intergenic
968042808 3:195601880-195601902 ATTATATGCTAAACAAGGGGTGG + Intergenic
1202743968 3_GL000221v1_random:81402-81424 ATGGCATGCTAATTAAGGGGCGG - Intergenic
968600122 4:1504718-1504740 ATGATATGCAAATTAAGGGGTGG + Intergenic
968846281 4:3043549-3043571 ATTATATGCTAAACAAGGGGTGG - Intergenic
969191524 4:5524928-5524950 ATTATATGCTAATTAAGAGGTGG + Intronic
969882111 4:10183202-10183224 ACTATATGCAAATCAAGGGGTGG + Intergenic
970505581 4:16726456-16726478 AGTACATGCAAAATAACAGGAGG + Intronic
970798857 4:19948023-19948045 ATTATATGCCAAACAAGGGGTGG + Intergenic
971805829 4:31356643-31356665 ATTATATGCTAAACAAGGGGTGG + Intergenic
971992403 4:33916241-33916263 ATTAGATACAAATTAAGGAGGGG - Intergenic
972129742 4:35817274-35817296 ATTTGATTCTAATTAAGGGGTGG - Intergenic
972659208 4:41098027-41098049 GTTACATGGAAGTTAATGGGAGG - Intronic
972980902 4:44699785-44699807 TTTACATCTAAATTAAGGGCAGG + Exonic
973148510 4:46859830-46859852 ATTACATGCAAATTAAGGGGTGG - Intronic
973149332 4:46867539-46867561 ATTACACGCAAATTAAGGGTTGG - Intronic
973360402 4:49159888-49159910 ATGGCATGCTAATTAAGGGGCGG + Intergenic
973399686 4:49628021-49628043 ATGGCATGCTAATTAAGGGGAGG - Intergenic
973752471 4:54035736-54035758 ATTAAATCCAAAGTAAGGAGGGG - Intronic
974072354 4:57135858-57135880 ATTGCATGCTAAACAAGGGGTGG + Intergenic
974256593 4:59464187-59464209 ATTACATGCAATTTTAGTGTTGG - Intergenic
974412160 4:61555763-61555785 ATTATATGCTAAACAAGGGGTGG + Intronic
975043035 4:69768771-69768793 ATGACATGCTAAACAAGGGGTGG - Intronic
975093323 4:70428111-70428133 ATTGCATGCAGTTTAAGGGGTGG - Intergenic
975206309 4:71647715-71647737 ATTATATGCTAAACAAGGGGTGG + Intergenic
975415040 4:74096281-74096303 ATTATATGCTAAACAAGGGGTGG + Intergenic
975966306 4:79976552-79976574 ATTATATGAAAATTAAGGGGTGG - Intronic
976004791 4:80417047-80417069 ATTATATGCTAAACAAGGGGTGG + Intronic
976491632 4:85677312-85677334 TTTATATGCACATTCAGGGGTGG + Intronic
976638386 4:87311224-87311246 ATTATATGCTAAACAAGGGGTGG - Intronic
977623648 4:99165837-99165859 ATTATATGCTAAACAAGGGGTGG + Intergenic
979511218 4:121556059-121556081 ATTACATGCAAATTAAGGGGCGG - Intergenic
979725330 4:123954328-123954350 ATTACATGCTAAACAAAGGGTGG + Intergenic
980014193 4:127629941-127629963 ATTATATGCTAAACAAGGGGTGG + Intronic
980155438 4:129098736-129098758 GTTATATGCTAAATAAGGGGTGG + Intronic
980587780 4:134840154-134840176 ATTACATTTAAATTAAAGAGGGG + Intergenic
980777687 4:137458156-137458178 ATTACACGCTAAACAAGGGGTGG + Intergenic
980782465 4:137509662-137509684 ATTATGTGCTAAATAAGGGGTGG + Intergenic
980913288 4:139012406-139012428 ATTACATGCTAACTAGGGAGAGG - Intergenic
981238494 4:142446908-142446930 ATTACAGAGAAATTAAGGAGGGG + Intronic
981318198 4:143362479-143362501 ATTACATGCTAAACAAGGGGCGG + Intronic
981916529 4:150039911-150039933 ATGACATGCTAATTATGGGGTGG + Intergenic
982265812 4:153537482-153537504 ATGATATGCTAAATAAGGGGTGG + Intronic
982371894 4:154642732-154642754 ATTACATGCAAATTAAGGAGTGG - Intronic
982863944 4:160487595-160487617 ATTATATGCTAAACAAGGGGTGG - Intergenic
983995354 4:174175522-174175544 ATTATATGCAAAACAAGGGGTGG + Intergenic
984432301 4:179664713-179664735 GTTACATGCAAATGAAGGGGTGG - Intergenic
984441659 4:179778442-179778464 ATTATATGCTAAACAAGGGGTGG - Intergenic
984650161 4:182262609-182262631 ATTATATGCTAAACAAGGGGTGG - Intronic
985334491 4:188877221-188877243 TTTACATGAAAATGAAGGCGAGG - Intergenic
1202757834 4_GL000008v2_random:81973-81995 ATGGCATGCTAATTAAGGGGAGG + Intergenic
985690906 5:1311737-1311759 ATTACATGTAGACTAAGGGGCGG + Intergenic
985831878 5:2239991-2240013 AGCAGATGCCAATTAAGGGGTGG + Intergenic
986209497 5:5657362-5657384 ACTACATGCAATTTAAGGGTGGG - Intergenic
986460105 5:7961378-7961400 ATTATATGCTAAACAAGGGGTGG + Intergenic
987371380 5:17196381-17196403 AATACATGGGAAGTAAGGGGTGG + Intronic
987496941 5:18658254-18658276 ATTGCATGCAGATTAAGGCGTGG + Intergenic
987819765 5:22947767-22947789 ATCACATGCAGATTAAGGGGTGG - Intergenic
988087171 5:26487123-26487145 ATTACATGCTAAACAAGGAGTGG + Intergenic
988184470 5:27842134-27842156 ATTATATGCTAAACAAGGGGTGG - Intergenic
988225529 5:28407476-28407498 AATATATGCAAATTAAGGAATGG + Intergenic
988859988 5:35267643-35267665 ATTACATGCAAAATGTGGGTTGG - Intergenic
988936639 5:36090042-36090064 ATTACATGCAAATTAAGGGGTGG + Intergenic
989130238 5:38100022-38100044 ATTATATGCTAAATAAGGGGTGG - Intergenic
989641917 5:43590855-43590877 ATTATATGCTAAATAAGGGGTGG - Intergenic
990155954 5:52877591-52877613 ATCACATGTACATTAAGAGGTGG - Intronic
990511383 5:56492403-56492425 ATTACATGTAGACTAAGGGGTGG + Intergenic
990538252 5:56746070-56746092 CTTTCATGCAAATCAAGGCGGGG - Intergenic
990600157 5:57350380-57350402 ATTATATGCTAAATAAGGGGTGG + Intergenic
990692799 5:58382569-58382591 ATTATATGCTAAATAAGGGATGG - Intergenic
991225551 5:64266724-64266746 ATTAATTCAAAATTAAGGGGAGG + Intronic
991226026 5:64273287-64273309 ATTACATGCTAAACAAGGGGTGG - Intronic
991432607 5:66563805-66563827 ATTATATGCTAAACAAGGGGTGG - Intergenic
991950817 5:71945496-71945518 ATTTTAAGCCAATTAAGGGGAGG + Intergenic
992505161 5:77379861-77379883 ATTACATGTAAATGAAGGGAGGG + Intronic
992542535 5:77778991-77779013 ATTATATGCTAAACAAGGGGTGG - Intronic
992796713 5:80260065-80260087 ATTATATGCTAAACAAGGGGTGG - Intergenic
994082984 5:95729070-95729092 ATTATATGCTAAACAAGGGGTGG - Intronic
994744804 5:103665148-103665170 ATTACATGACCATCAAGGGGAGG - Intergenic
995370471 5:111412884-111412906 ATTACATATAAATTAAGGGTTGG - Intronic
995840187 5:116436642-116436664 ATTGCATGCAGATTAAGGGGTGG - Intergenic
995882515 5:116858615-116858637 ATTATATGCTAAATAAGGGGTGG + Intergenic
996143947 5:119950013-119950035 ATTATATGCTAATCAAGGAGTGG - Intergenic
996191377 5:120546953-120546975 GTTACATGCCAATTAAGAGAAGG + Intronic
996573751 5:124960589-124960611 ATTATATGCAAATTAAGGAGTGG + Intergenic
996707749 5:126514161-126514183 ATTATATGCTAAACAAGGGGTGG + Intergenic
997065229 5:130551722-130551744 ATTATATGCAAATTAATAGGTGG - Intergenic
997065370 5:130553528-130553550 ATTGCATGCAAATTAAAAGGTGG - Intergenic
997065448 5:130554203-130554225 CTTACAGGCAAATTAAGGGGTGG - Intergenic
997222622 5:132181733-132181755 ATTACATGTAGATTAAGGGGAGG + Intergenic
997463255 5:134070041-134070063 ATCACATGCTAAACAAGGGGTGG - Intergenic
997775864 5:136604021-136604043 ATTTCATGCTCATTAATGGGTGG - Intergenic
998477687 5:142435414-142435436 ATAACATGCAGATTAAAGGGCGG + Intergenic
998517271 5:142768024-142768046 ATTATATGCTAATTAAGAGGTGG + Intergenic
998982981 5:147725270-147725292 ATTACATGCTAAACAAGGGGTGG - Intronic
999584933 5:153079876-153079898 ATTATATGCTAAACAAGGGGTGG - Intergenic
1000090500 5:157925863-157925885 ATTATATGCCAAACAAGGGGTGG + Intergenic
1000310972 5:160044428-160044450 ATTATATGCTAAGCAAGGGGTGG + Intronic
1000520890 5:162293365-162293387 ATTACATGTAGATTAAAGGGTGG - Intergenic
1000543562 5:162570501-162570523 ATTACATGCAAATTAAGGGGAGG - Intergenic
1000600914 5:163273630-163273652 ATTACATGCTAAACAAGGGGTGG + Intergenic
1000646508 5:163766380-163766402 ATTATATGCAAATTAAAGGGTGG + Intergenic
1001189589 5:169616279-169616301 ATTATATCCAAAGTAAGGAGAGG + Intergenic
1001365058 5:171128978-171129000 ATTATATGCTCATTAAGGGCAGG - Intronic
1001437484 5:171711604-171711626 TTTATATGCAAATTAAAGAGTGG + Intergenic
1001903823 5:175454246-175454268 ATTATATGCTAAACAAGGGGTGG + Intergenic
1002708079 5:181176369-181176391 ATTATATGCTAAACAAGGGGTGG + Intergenic
1005018889 6:21399249-21399271 ATTATATGCTAAACAAGGGGTGG - Intergenic
1005331641 6:24756381-24756403 ATTATATGCTAAACAAGGGGTGG + Intergenic
1005479819 6:26244955-26244977 ATTATTTGCAAATTAAGGGCAGG - Intergenic
1005570019 6:27136008-27136030 ACTACATGCTAAACAAGGGGTGG + Intergenic
1006213363 6:32416227-32416249 ATTACAAGCTAAATAAGGGGTGG + Intergenic
1006234944 6:32621699-32621721 ATTATATGCAAATTAAGAGGTGG + Intergenic
1007340640 6:41189153-41189175 ATTATATGCTAAACAAGGGGTGG + Intergenic
1008928125 6:56908911-56908933 ATTATATGCTAAACAAGGGGTGG - Intronic
1009370475 6:62894359-62894381 ATTACATGCAAATTAAAGTGTGG + Intergenic
1009604359 6:65848117-65848139 ATGATATGCTAAATAAGGGGTGG + Intergenic
1009649990 6:66463328-66463350 ATTACATAAAAATTAAGGGGTGG - Intergenic
1009770002 6:68133692-68133714 AATACATGAAAATTAAGGCCGGG - Intergenic
1010137968 6:72577338-72577360 ATTACATGTAGATTAAGGGATGG - Intergenic
1010542556 6:77109794-77109816 ATTATATGCTAAACAAGGGGTGG + Intergenic
1010675915 6:78742769-78742791 ATTGCATGCAAATTAAGGGGTGG - Intergenic
1011257443 6:85437549-85437571 ATTATATGCTAAAGAAGGGGTGG - Intergenic
1011528645 6:88295521-88295543 ATTATATGCTAAACAAGGGGTGG + Intergenic
1011545404 6:88477421-88477443 ATTATATGTAAATTAAGGGGTGG + Intergenic
1011809540 6:91114439-91114461 ATTATATGCTAAACAAGGGGTGG - Intergenic
1012665979 6:101970502-101970524 ATTATATGAAAATTAAATGGTGG + Intronic
1012999401 6:106007534-106007556 ATTACATGCAACTAAAGATGGGG + Intergenic
1013523521 6:110954241-110954263 ATTATATGCTAAACAAGGGGTGG - Intergenic
1014022362 6:116605714-116605736 ATTATATGCTAAACAAGGGGTGG + Intergenic
1014934177 6:127366721-127366743 ATTATATTAAAATTAAGGGGTGG + Intergenic
1015044475 6:128761164-128761186 ATTATATGCTAAACAAGGGGTGG - Intergenic
1015139608 6:129914776-129914798 ATTAAATGCTCATTAAGTGGTGG - Intergenic
1015270433 6:131332699-131332721 ATTATATGCTAAACAAGGGGTGG - Intergenic
1015696939 6:135990934-135990956 ATTATATGCTAAATAGGGGGTGG + Intronic
1016204135 6:141452609-141452631 ATAACATCCAGATTAAAGGGTGG + Intergenic
1016406854 6:143740107-143740129 ATTACATGCTAAACAAGGGGTGG + Intronic
1017392904 6:153960256-153960278 ATTATATGCTAAATAAGGGGTGG - Intergenic
1017406340 6:154123620-154123642 ATTATATGCTAAACAAGGGGTGG + Intronic
1017736486 6:157369511-157369533 ATTACATGCAGATTAAAGGGTGG - Intergenic
1017814104 6:158004561-158004583 ATTATATGCTAAATAAGGGGTGG - Intronic
1018080241 6:160253305-160253327 ATTATATGCAAATTAAGGGGTGG + Intronic
1018415620 6:163600015-163600037 ATTACATGCAAATTAAGGAGCGG - Intergenic
1018454667 6:163941279-163941301 ATTATATGCTAAACAAGGGGTGG - Intergenic
1018623257 6:165751797-165751819 GGTGCATGCAAATTGAGGGGTGG - Intronic
1019029088 6:168995030-168995052 ATTACATGCAAGTTAGGGGCGGG + Intergenic
1019096011 6:169579710-169579732 ATTATATGCTACATAAGGGGTGG - Intronic
1019355751 7:577944-577966 ATTATGTGCACATTAAGGGGTGG + Intronic
1019591298 7:1835802-1835824 ATTATATGCTAATGAAGGGGTGG + Intronic
1019951475 7:4376527-4376549 ATTATATGCTAAACAAGGGGTGG - Intergenic
1020008514 7:4795193-4795215 ATTACATGCTAAACAAGGGGCGG - Intergenic
1020430151 7:8110286-8110308 ATTATATGCTAAACAAGGGGTGG - Intergenic
1020782038 7:12529935-12529957 ACTACATGCAAATTAAGGGGTGG + Intergenic
1021061918 7:16123579-16123601 ATTACATGCTATTTACTGGGTGG - Intronic
1021406674 7:20275807-20275829 ATTAGATGAAATTTATGGGGTGG + Intergenic
1021563499 7:21992699-21992721 ATTGCTTGCAGGTTAAGGGGTGG - Intergenic
1021650426 7:22827817-22827839 ATTATATGCAAATTAAGGGGTGG - Intergenic
1022299467 7:29089694-29089716 ATTACATGCAGATTAAGGGTTGG - Intronic
1022922391 7:35028759-35028781 ATTATATGCTAAACAAGGGGTGG + Intronic
1023603932 7:41910011-41910033 ATTATATGCTAAACAAGGGGTGG - Intergenic
1023932876 7:44717094-44717116 ATTATATGCTAAACAAGGGGTGG + Intergenic
1024039963 7:45545066-45545088 ATTATATGCTAAATAAGGGGTGG - Intergenic
1024652691 7:51419174-51419196 ATTAGATGCTAATTAAGGGGTGG + Intergenic
1024747673 7:52427178-52427200 ATTACATGCAAATTAAAGGGTGG - Intergenic
1025037871 7:55609813-55609835 ATTAGATGCTAATTAAGGGGTGG + Intergenic
1025223265 7:57134498-57134520 ATTATATGCTAAGCAAGGGGTGG - Intronic
1025741969 7:64204995-64205017 ATTATATGCTAACCAAGGGGTGG + Intronic
1025746439 7:64246928-64246950 ATTATATGCTAAACAAGGGGTGG + Intronic
1026118579 7:67517146-67517168 ATGATATGCTAATTAAGGAGTGG - Intergenic
1026128057 7:67596904-67596926 ATTACATTCAAATGAAGGAGTGG + Intergenic
1026236245 7:68529522-68529544 ATTATATACAAATTAAGGGGAGG - Intergenic
1026535107 7:71232749-71232771 ATTACACGCAAATTAAGGGGTGG + Intronic
1026544739 7:71312104-71312126 ATACCATGCAAATTAAGGCATGG - Intronic
1026877725 7:73889169-73889191 ATTATATGCAAATTAAGGGGTGG - Intergenic
1026921703 7:74160451-74160473 ATTATATGCTAAACAAGGGGTGG - Intergenic
1027250593 7:76396389-76396411 AGTATATGCAAATTAGGGGGTGG - Intronic
1027337988 7:77174483-77174505 ATTAGATGCAAATTAAGGACTGG + Intronic
1027365011 7:77448180-77448202 ATTATATGCTAAACAAGGGGTGG + Intergenic
1027529852 7:79316754-79316776 ATTAAGTGCAAATTATGTGGTGG + Intronic
1028072555 7:86469720-86469742 ATAACCAGCAAATTAAAGGGAGG - Intergenic
1028075066 7:86502507-86502529 ATTGCATGCAGATTAAGTGGTGG + Intergenic
1028165387 7:87532659-87532681 ATTACATGCTAAACAAGGGGTGG - Intronic
1028317906 7:89427048-89427070 ATTATGTGCAAATTAATGGGTGG + Intergenic
1029094272 7:98072688-98072710 CCTATATGCAAATAAAGGGGTGG + Intergenic
1029427659 7:100506626-100506648 ATTATATGCAAATTAAGGGGTGG + Intergenic
1029499495 7:100919427-100919449 ATGACATGCTAAACAAGGGGTGG + Intergenic
1029576663 7:101407855-101407877 ATCATATGCAAATTAAGGGGCGG + Intronic
1029600313 7:101559410-101559432 ATTGCATGCAGATTAAGGGCTGG + Intergenic
1029618816 7:101677255-101677277 ATTACATGCAAATGAAGAGGTGG - Intergenic
1029777746 7:102696328-102696350 ATTAGATGCAAATTAAGGACTGG - Intergenic
1030155923 7:106455629-106455651 ATTATATGCTAAACAAGGGGTGG + Intergenic
1030174716 7:106640221-106640243 ATTATATGCTAAATAAGGGGTGG - Intergenic
1031247640 7:119337248-119337270 ATTACATGCAGATTAAAGAGAGG + Intergenic
1031823702 7:126535568-126535590 ATTGCATGCAGAGTAAGGGGTGG + Intronic
1031896755 7:127358594-127358616 ATCACATGTAGATTAAGGGAAGG - Intronic
1032338620 7:131049801-131049823 ATTATATGCTAAACAAGGGGTGG + Intergenic
1032340939 7:131072276-131072298 ATTATATGCTAAACAAGGGGTGG - Intergenic
1032359323 7:131240271-131240293 GCTACCTACAAATTAAGGGGAGG + Intronic
1033161550 7:139001522-139001544 ATTACATGCTAAACAAGGGGTGG - Intergenic
1033162138 7:139006996-139007018 ATTACATGATAAACAAGGGGTGG - Intergenic
1033351502 7:140565983-140566005 ATTATATGCTAAACAAGGGGTGG - Intronic
1033847182 7:145447947-145447969 ATTACAGGCAAATTAAGGAGTGG - Intergenic
1034091475 7:148368247-148368269 ATTATCTGCAAGTTGAGGGGTGG + Intronic
1034093794 7:148388044-148388066 ATTATATGCTAAACAAGGGGTGG - Intronic
1034110004 7:148527636-148527658 ATTACATGCAAATTAAAGGGTGG + Intergenic
1034383999 7:150722769-150722791 ACTATATGCAAATTTAGGGGTGG + Exonic
1034507392 7:151504297-151504319 AAAACATGCAATTTAAGTGGGGG + Intronic
1034707335 7:153157290-153157312 ATTACATGCAAATTAAGGGGCGG - Intergenic
1035071741 7:156149891-156149913 ATCACATCCAAATTAAAGGAAGG + Intergenic
1035127654 7:156620056-156620078 ATGACATGCTAAACAAGGGGTGG + Intergenic
1035736592 8:1891760-1891782 ATTATATGCCCACTAAGGGGTGG - Intronic
1035813279 8:2511613-2511635 ATTATATGCTAATTAAGGGGCGG + Intergenic
1035967517 8:4209828-4209850 ATTACATGCAAAATAAGGAGCGG + Intronic
1035976406 8:4316666-4316688 CTCAAATGCAAACTAAGGGGGGG + Intronic
1036125946 8:6062040-6062062 ATTACATGCACATTAAAGGGCGG - Intergenic
1036576033 8:10028434-10028456 ATTATATGCTAAACAAGGGGTGG - Intergenic
1036576243 8:10030062-10030084 ATAATATGCTAATCAAGGGGTGG - Intergenic
1036739109 8:11345977-11345999 ATTGCATACAGATTAAGGGGCGG + Intergenic
1037053509 8:14406776-14406798 ATTATTTTCAAATTAAAGGGTGG - Intronic
1037124848 8:15335491-15335513 ATTATATGCATATTAAAGGCTGG - Intergenic
1037163687 8:15801176-15801198 ATTATATGCTAAACAAGGGGTGG + Intergenic
1037188843 8:16097907-16097929 ATTATATGTTAAATAAGGGGTGG - Intergenic
1037198760 8:16224215-16224237 ATTATATGCAAATTAAAGGGTGG - Intronic
1037304325 8:17489426-17489448 ATTATATGCTAAACAAGGGGTGG + Intergenic
1037314144 8:17584953-17584975 ATTATATGCTAAACAAGGGGTGG + Intronic
1037367612 8:18139725-18139747 ATTACATGCTAAACAAGGGGTGG + Intergenic
1037466701 8:19168060-19168082 ATTATATGCTAAACAAGGGGTGG - Intergenic
1037471462 8:19215434-19215456 ATTATATGTAAATTAAGGGGTGG - Intergenic
1037595704 8:20352484-20352506 ATTACATGCTAAACAAGGGGTGG + Intergenic
1037600352 8:20388718-20388740 ATCACATGCAAATTAAGGGGTGG + Intergenic
1037614654 8:20507843-20507865 TTTACATGCTAAACAAGGGGTGG - Intergenic
1037736331 8:21569887-21569909 ATTACATGCTAAACAAGGGGTGG + Intergenic
1038338887 8:26667642-26667664 ATTATATGCTAAACAAGGGGTGG - Intergenic
1038387812 8:27165961-27165983 ATTGCATGCAGACTAAAGGGTGG + Intergenic
1038448982 8:27626787-27626809 ATTATATGCAAATTAAGGGGTGG - Intergenic
1038675326 8:29617643-29617665 ATCACATGCAAAACAAGGGGTGG - Intergenic
1039080103 8:33725670-33725692 ATTATATGCTAAACAAGGGGTGG - Intergenic
1039338700 8:36623149-36623171 ATTGCATGTAGATTAAGGGGTGG - Intergenic
1039375284 8:37026662-37026684 GTTATATGCAAATTAAGGGTTGG - Intergenic
1039604147 8:38867014-38867036 ATTACATGCTAAACAAGGGGTGG - Intergenic
1039827453 8:41187102-41187124 ATTATATGCTAAACAAGGGGTGG + Intergenic
1040939588 8:52818595-52818617 ATTACATGTGGATGAAGGGGTGG - Intergenic
1041014533 8:53579174-53579196 ATTACATGCAAACTAAGTGGTGG + Intergenic
1041073879 8:54151440-54151462 ATTATATGCTAAACAAGGGGTGG - Intergenic
1041437424 8:57858019-57858041 ATCACATGCATATTGAGGAGAGG - Intergenic
1041840666 8:62266838-62266860 ATTATATACAAATTAAAGGGTGG - Intronic
1041924664 8:63224244-63224266 ATTATATGCTAAACAAGGGGTGG + Intergenic
1042746868 8:72118075-72118097 ATTACATGCAAATTAAGGGATGG - Intronic
1043118534 8:76290843-76290865 ATTATATGCTAAATAAGGGGTGG - Intergenic
1043198702 8:77334749-77334771 ATTACATAGAAATTCAGGAGTGG - Intergenic
1043754469 8:83985724-83985746 GTTATATGCTAATTCAGGGGTGG + Intergenic
1043853805 8:85242907-85242929 ATTACATGCTAAACAAGGGGTGG + Intronic
1044155688 8:88843599-88843621 ATTACATGCAAATTAAGTGGTGG + Intergenic
1044233514 8:89805491-89805513 ATTATATGCTAAACAAGGGGTGG - Intergenic
1044439230 8:92203937-92203959 ATTATATGCTAAACAAGGGGTGG + Intergenic
1044564809 8:93651540-93651562 ATTACATGCAAATTAAGGGATGG + Intergenic
1044986797 8:97763057-97763079 ATTATATGCTAAACAAGGGGTGG - Intergenic
1044991731 8:97802277-97802299 ATTATATGCTAAACAAGGGGTGG + Intronic
1045012478 8:97970168-97970190 ATTGCAGGCACGTTAAGGGGAGG + Intronic
1045290561 8:100828999-100829021 ATTATATGCTAAACAAGGGGTGG - Intergenic
1045428076 8:102087016-102087038 ATTATATGCTAAGGAAGGGGTGG - Intronic
1045428609 8:102092270-102092292 ATTATATGCTAAATAAGGGGTGG - Intronic
1045573773 8:103396823-103396845 ATTGCAAGCAACTTAGGGGGTGG - Intergenic
1046920103 8:119718830-119718852 ATTATATGCTAAACAAGGGGTGG - Intergenic
1047460170 8:125056004-125056026 ATTGCTTGCAAATAATGGGGAGG - Intronic
1047559575 8:125972215-125972237 GTTCTATGCTAATTAAGGGGTGG - Intergenic
1048105522 8:131404079-131404101 ACTATATGCTAATTAAAGGGAGG - Intergenic
1048886835 8:138915690-138915712 ATTACATGCTAAACAAGGGGTGG - Intergenic
1049345899 8:142138474-142138496 AATTAATGCAAATTAAGGGGCGG - Intergenic
1049678619 8:143905002-143905024 CTTACATGCAAATTAAGGGGCGG - Intergenic
1050620366 9:7445962-7445984 ATTACATGCAAATTAAAAAGTGG + Intergenic
1050920102 9:11189413-11189435 ATTACATGCAAATTATTGGGGGG + Intergenic
1050959220 9:11706018-11706040 ATTACTTGCTAAACAAGGGGTGG - Intergenic
1051011163 9:12416236-12416258 AGTCAAAGCAAATTAAGGGGCGG + Intergenic
1051363503 9:16303282-16303304 ATTATATGCTAAACAAGGGGTGG - Intergenic
1051772600 9:20594918-20594940 ATTATATGCTAAACAAGGGGTGG - Intronic
1051859629 9:21609647-21609669 ATTACATGCTAAACAAGGAGTGG - Intergenic
1052135615 9:24906368-24906390 ATTACATGCAAATTAAGGGGTGG + Intergenic
1052141688 9:24992872-24992894 ATGACATACAAATAAAGGAGAGG - Intergenic
1052332149 9:27281125-27281147 ATTGCATGCTAATCAAGGGGCGG - Intergenic
1052403230 9:28026942-28026964 GTTGCATGCAAATTTAGGAGAGG - Intronic
1053060428 9:35026543-35026565 ATTATATGCTAAAAAAGGGGTGG - Intergenic
1053125134 9:35574966-35574988 ACTACATGCAAATTAAGGGGTGG - Intergenic
1053562934 9:39214882-39214904 ATTATATGCTAAACAAGGGGTGG + Intronic
1053572267 9:39321248-39321270 ATTACATGCAGATTCAGGGGTGG - Intergenic
1053623660 9:39845784-39845806 ATTACATGTAGATTCAGGGGTGG - Intergenic
1053828728 9:42052828-42052850 ATTATATGCTAAACAAGGGGTGG + Intronic
1053881209 9:42597444-42597466 ATTACATGTAGATTCAGGGGTGG + Intergenic
1053891454 9:42696869-42696891 ATTACATGCAGATTCAGGGGTGG - Intergenic
1054093827 9:60879959-60879981 ATTACATGCAGATTCAGGGGTGG - Intergenic
1054115304 9:61155883-61155905 ATTACATGCAGATTCAGGGATGG - Intergenic
1054124878 9:61297763-61297785 ATTACATGCAGATTCAGGGGTGG + Intergenic
1054134214 9:61404173-61404195 ATTATATGCCAAACAAGGGGTGG - Intergenic
1054220238 9:62404915-62404937 ATTACATGTAGATTCAGGGGTGG + Intergenic
1054230477 9:62504257-62504279 ATTACATGTAGATTCAGGGGTGG - Intergenic
1054592452 9:67026659-67026681 ATTACATGCAGATTCAGGGATGG + Intergenic
1054601831 9:67134626-67134648 ATTATATGCTAAACAAGGGGTGG - Intergenic
1054934992 9:70677278-70677300 ATTATATGTAGATTAAGGGGTGG - Intronic
1055033789 9:71796626-71796648 ATTACATGCAAATCAAGGGGTGG - Intronic
1055056529 9:72029270-72029292 ATTATATGCTAAACAAGGGGTGG - Intergenic
1055079491 9:72255209-72255231 ATTACATGCAAATTAACGGGTGG + Intronic
1055348299 9:75359387-75359409 ATTATATGCTAAACAAGGGGTGG + Intergenic
1055921658 9:81467330-81467352 ATTATATGCTAAACAAGGGGTGG - Intergenic
1056054895 9:82811341-82811363 ATGACATGCTAAATAAGGGGTGG - Intergenic
1056393899 9:86164101-86164123 ATTATATGCTAAACAAGGGGTGG + Intergenic
1056396243 9:86183949-86183971 ATTACATGCCAAACAAGGAGTGG - Intergenic
1056681337 9:88721641-88721663 ATTATATGCTAAACAAGGGGTGG + Intergenic
1056727923 9:89138352-89138374 ATTATATGCTAAATAAGGGGTGG + Intronic
1056739484 9:89241816-89241838 ATTATATGCTAAATAAGGGGTGG - Intergenic
1056918341 9:90763552-90763574 ATTACTTGCAAATTCAGGGGTGG + Intergenic
1056919041 9:90769940-90769962 ATTACATGCAAATTAAGGGGTGG + Intergenic
1057364059 9:94401910-94401932 ATTATATGCTAAACAAGGGGTGG + Intronic
1057428069 9:94970008-94970030 ATGACATGCAGATTCAGGAGAGG + Intronic
1057596766 9:96421185-96421207 ATGATATGCTAATCAAGGGGTGG - Intergenic
1057659277 9:96986151-96986173 ATTATATGCTAAACAAGGGGTGG - Intronic
1057780915 9:98049435-98049457 ATTATATGCTAAAGAAGGGGTGG + Intergenic
1057943145 9:99302327-99302349 ATTGTATGCTAAATAAGGGGTGG - Intergenic
1058193732 9:101950078-101950100 ATGTCATGCTAACTAAGGGGTGG - Intergenic
1058194588 9:101956908-101956930 ATGACATGCTAATTAAGGGGCGG - Intergenic
1058287372 9:103195457-103195479 ATTATATGCTAGATAAGGGGTGG - Intergenic
1059911988 9:119054880-119054902 ATTATATGCTAAACAAGGGGTGG + Intergenic
1060172774 9:121475318-121475340 ATGACATGCTAAACAAGGGGTGG - Intergenic
1060499381 9:124141469-124141491 ATTATATGCTAAATAAGGGGTGG - Intergenic
1060538966 9:124416389-124416411 ATTACATGCAGATTAAGGGGTGG - Intergenic
1060682963 9:125581864-125581886 AACACATGCAAATTAAATGGCGG - Intronic
1060935614 9:127513688-127513710 ATGACATGCTAAACAAGGGGTGG - Intronic
1061437324 9:130573177-130573199 ATTAAATGCAAATTCAGGCCAGG + Intergenic
1062130537 9:134890375-134890397 ATTACATACTAAACAAGGGGTGG - Intergenic
1062139876 9:134950081-134950103 ATTACAAGCAGATTAAGGGGTGG + Intergenic
1062149513 9:135010373-135010395 ATTGCATGCAGATTAAGGGGCGG + Intergenic
1203689437 Un_GL000214v1:28981-29003 ATGGCATGCTAATTAAGGGGCGG + Intergenic
1203753186 Un_GL000218v1:98813-98835 ATGACATGCTAATTAAGGGGCGG - Intergenic
1203712600 Un_KI270742v1:111368-111390 ATGGCATGCTAATTAAGGGGCGG - Intergenic
1203538623 Un_KI270743v1:66837-66859 ATGGCATGCTAATTAAGGGGAGG + Intergenic
1203556194 Un_KI270743v1:209687-209709 ATGGCATGCTAATTAAGGGGAGG - Intergenic
1203646838 Un_KI270751v1:75072-75094 ATGGCATGCTAATTAAGGGGCGG - Intergenic
1185562869 X:1073055-1073077 ATTACATGCAAATGAAGGGGCGG - Intergenic
1185682374 X:1899104-1899126 ATTACATGCAAATGAAGGGGCGG + Intergenic
1185811614 X:3115569-3115591 ATTGCATGCAGATTAAGGTGCGG - Intergenic
1185849327 X:3470573-3470595 ATTATAGGCAAAGCAAGGGGTGG - Intergenic
1185886251 X:3785923-3785945 ATTATATGCTAAACAAGGGGTGG + Intergenic
1186123274 X:6385421-6385443 ATTATATGCCAAACAAGGGGTGG + Intergenic
1186165666 X:6823732-6823754 ATGATATGCTAAATAAGGGGTGG + Intergenic
1186833451 X:13414164-13414186 ATTACATGCTAAACAAGGGGTGG + Intergenic
1186883551 X:13890324-13890346 ATTACATGCTAAACAAGGAGTGG - Intronic
1187111731 X:16308848-16308870 ATTATATGCTAAACAAGGGGTGG + Intergenic
1187499730 X:19829842-19829864 ATTATATGCCAAACAAGGGGTGG + Intronic
1188126212 X:26372935-26372957 ATTATATGCTAAACAAGGGGTGG + Intergenic
1188126750 X:26377645-26377667 ATTATATGCTAAACAAGGGGTGG - Intergenic
1188133663 X:26468558-26468580 ATTACTTGCTAAACAAGGGGTGG + Intergenic
1188187652 X:27134692-27134714 TTTACATGCAAATTAAGGAGTGG - Intergenic
1188213107 X:27446584-27446606 ATTAAATGCTAAATAAGGGGTGG + Intergenic
1188335994 X:28933765-28933787 ATTATATGCTAAATAAAGGGTGG + Intronic
1188626356 X:32289833-32289855 ATTATATGCTAAACAAGGGGTGG - Intronic
1188928157 X:36070934-36070956 ATTGCATGCAGATTAAGGGGTGG - Intronic
1189086145 X:38026600-38026622 ATTATATGCTAAACAAGGGGTGG + Intronic
1189390381 X:40571326-40571348 ATTATATGCTAAACAAGGGGTGG + Intergenic
1189650909 X:43188500-43188522 ATTACATGCAAATTAAGGGGTGG - Intergenic
1189691034 X:43617059-43617081 ATTATATGCTAAACAAGGGGTGG + Intergenic
1189894181 X:45636425-45636447 GTTACAAGTAAATGAAGGGGTGG - Intergenic
1190244278 X:48680739-48680761 ATTATATGCTAAACAAGGGGTGG - Intronic
1190251283 X:48728229-48728251 GTTACATGCAAATTAAGGGATGG - Intergenic
1190628400 X:52359946-52359968 ATTACGTGTATATTAAGGGCGGG - Intergenic
1190953320 X:55167471-55167493 ATTATATGTACATTAAGGGCAGG - Intronic
1191613426 X:63141295-63141317 ATTATATGCTAAATAAGGGGTGG - Intergenic
1191617020 X:63180730-63180752 ATTATATGCTAAACAAGGGGTGG - Intergenic
1191619277 X:63198193-63198215 ATTATATGCTAAACAAGGGGTGG + Intergenic
1191622871 X:63237632-63237654 ATTATATGCTAAATAAGGGGTGG + Intergenic
1192016661 X:67338821-67338843 ATTACATGCAGATCAAGGGATGG + Intergenic
1192416819 X:70988501-70988523 GTTACATGCAAATTAAGGGGTGG + Intergenic
1193428477 X:81370322-81370344 ATTTTATGAAAATTAAAGGGAGG + Intergenic
1193546886 X:82842434-82842456 ATTACATGCTAAATATGGGGTGG + Intergenic
1194067162 X:89275991-89276013 ATTACATGCAAATGAAGGGGTGG + Intergenic
1194152788 X:90345680-90345702 ATTACATGCAAATTAAGGGGTGG + Intergenic
1194896488 X:99447770-99447792 ATTATATGCTAAATAAGGGGTGG - Intergenic
1194997972 X:100612462-100612484 ATTATATGCTAAACAAGGGGTGG - Intergenic
1195268837 X:103211358-103211380 ATTACACACAAATTAGGGAGTGG - Intergenic
1195313084 X:103653036-103653058 CTTATATGCAAATTAAGTGGTGG + Intergenic
1195373929 X:104207048-104207070 ATTACATGCAAATTAAGGGGTGG + Intergenic
1195539978 X:106052604-106052626 ATTATATGCAAATTAAGGTAAGG + Intergenic
1195922860 X:110000923-110000945 ATTATATGCTAAACAAGGGGTGG + Intergenic
1196161937 X:112494866-112494888 ATTACATGCCAAACAAGTGGTGG + Intergenic
1196529798 X:116772405-116772427 ATTATATGCTAAACAAGGGGTGG + Intergenic
1197164864 X:123365927-123365949 ATTACATGTTAAACAAGGGGTGG + Intronic
1198079221 X:133223382-133223404 GTTTTATGCAAATGAAGGGGTGG - Intergenic
1198175282 X:134148627-134148649 ATTGCATGCAGATTAATGGGCGG - Intergenic
1198272692 X:135069200-135069222 ATTGCATGCAAATTAAGGGGTGG - Intergenic
1198761397 X:140036514-140036536 ATTATATGCTAAATAAGGAGTGG + Intergenic
1198846588 X:140918761-140918783 ATTATATGCAAATTAAGGGGTGG - Intergenic
1198928526 X:141826046-141826068 ATTATATGCTAACTAAGAGGTGG + Intergenic
1198965658 X:142227114-142227136 ATTACATGCTAAACAAGGGGTGG + Intergenic
1199367159 X:147000615-147000637 ATTATATGCTAAACAAGGGGTGG + Intergenic
1199404589 X:147442294-147442316 ATTATATGCTAAACAAGGGGTGG - Intergenic
1199948529 X:152686818-152686840 ATTATATGCTAAACAAGGGGTGG - Intergenic
1199961150 X:152781638-152781660 ATTATATGCTAAACAAGGGGTGG + Intergenic
1200499132 Y:3922425-3922447 ATTACATGCAAATTAAGGGGTGG + Intergenic
1200721323 Y:6610200-6610222 ATTACATGCAAATGAAGGGGTGG + Intergenic
1200785856 Y:7259760-7259782 ATTATATGCTAAACAAGGGGTGG - Intergenic
1201166830 Y:11216382-11216404 ATGACATGCTAATTAAGGGGCGG - Intergenic
1201255791 Y:12107120-12107142 ATTATATGCTAAACAAGGGGTGG + Intergenic
1201328822 Y:12796675-12796697 ATTATATGCAAAACAAGGGTTGG + Intronic
1201406492 Y:13655310-13655332 ATTATATGCTAAACAAGGGGTGG - Intergenic
1201605000 Y:15774453-15774475 ATTACATGTCAAACAAGGGGTGG + Intergenic
1201636167 Y:16125581-16125603 ATTACATTCTAAACAAGGGGTGG + Intergenic
1201690093 Y:16753482-16753504 TCTATATGGAAATTAAGGGGTGG - Intergenic
1201787054 Y:17796047-17796069 ATTATATGCTCATTAAGGGAAGG + Intergenic
1201814499 Y:18109941-18109963 ATTATATGCTCATTAAGGGAAGG - Intergenic
1202067733 Y:20958372-20958394 ATTATATGCTAAACAAGGGGTGG + Intergenic
1202302115 Y:23427835-23427857 ATTATATGCTAAACAAGGGGTGG + Intergenic
1202568696 Y:26242763-26242785 ATTATATGCTAAACAAGGGGTGG - Intergenic