ID: 1144424859

View in Genome Browser
Species Human (GRCh38)
Location 17:15132305-15132327
Sequence TCAATTACATGCAAATTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1132
Summary {0: 23, 1: 105, 2: 207, 3: 313, 4: 484}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144424859_1144424864 -10 Left 1144424859 17:15132305-15132327 CCCCTTAATTTGCATGTAATTGA 0: 23
1: 105
2: 207
3: 313
4: 484
Right 1144424864 17:15132318-15132340 ATGTAATTGAAAGTGGGCTTAGG No data
1144424859_1144424865 22 Left 1144424859 17:15132305-15132327 CCCCTTAATTTGCATGTAATTGA 0: 23
1: 105
2: 207
3: 313
4: 484
Right 1144424865 17:15132350-15132372 ATGCAGTTGCCACAGTCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144424859 Original CRISPR TCAATTACATGCAAATTAAG GGG (reversed) Intergenic
900688617 1:3965723-3965745 TTAATGACATGCAAATTAAGGGG - Intergenic
901622826 1:10602745-10602767 TTAATTACAAGCAAACTCAGGGG + Intronic
901774871 1:11553621-11553643 TTTATTATATGTAAATTAAGGGG + Intergenic
901776627 1:11564597-11564619 CTAATTACATGCAGATTAAGGGG - Intergenic
901779191 1:11581752-11581774 CTAATTATATGCAGATTAAGGGG - Intergenic
901785738 1:11623245-11623267 TAAATTACAGGCAAAATGAGAGG - Intergenic
902153401 1:14463085-14463107 TTAATTACATGCAAATTAAGGGG + Intergenic
902155841 1:14485580-14485602 TTAATTGCGTGCAGATTAAGGGG - Intergenic
902260120 1:15218854-15218876 TTAGTCACATGCAAATTAAGGGG - Intronic
902959900 1:19955887-19955909 TGAATGACATGCTAATTAAGGGG - Intergenic
903197667 1:21704058-21704080 TCTATTACATGCAAATGATAAGG + Intronic
903794838 1:25920857-25920879 TTAATTACATGCAAATTAAGGGG - Intergenic
903824410 1:26132778-26132800 TTAATTATATGCAAATTAAGGGG - Intergenic
904348551 1:29890104-29890126 TTAATGACATGCAGATTAAGGGG - Intergenic
904407836 1:30305035-30305057 TTAATTACATGCAAATTAAGGGG - Intergenic
904455989 1:30648445-30648467 TTAATTATATGCAAATTAGGTGG + Intergenic
904718358 1:32486514-32486536 TTAGTTACATGCAAATTAAGGGG + Exonic
905039030 1:34937943-34937965 TTAATTATATGCAAATTAGGGGG - Intergenic
905712685 1:40119903-40119925 TTAATTATATGTAAATTAAGGGG + Intergenic
905764942 1:40592519-40592541 TCAATTACACACAAATTCAGGGG - Intergenic
906218873 1:44061602-44061624 TTAATTACATGCAAATTAAGGGG - Intergenic
906234414 1:44195890-44195912 TCGATTACATGCAAATTAAGGGG - Intergenic
906425079 1:45704956-45704978 TTAATTATGTGCAAATTAAGTGG - Intronic
906870180 1:49470748-49470770 TCAATTGTATGCAAATTAAGGGG - Intronic
906978993 1:50608114-50608136 TTAATTACATGCAAATTAAGGGG + Intronic
907652648 1:56310464-56310486 TTAATTGCATGCAGATTAAGGGG + Intergenic
908297546 1:62728105-62728127 TTAATTGTATGCAGATTAAGGGG + Intergenic
908683258 1:66685929-66685951 TCATTTACATACATATTTAGTGG + Intronic
908693839 1:66814210-66814232 GCAATAAAATGCAAATTAAAAGG + Intronic
908724329 1:67158479-67158501 TTAATCATATACAAATTAAGGGG + Intronic
908887721 1:68809374-68809396 TAGATTGCATGCAAATTAGGTGG + Intergenic
908934282 1:69355945-69355967 TTAATTATATACAAATTAAGAGG + Intergenic
909051990 1:70777217-70777239 TCAATTACATGCAAATTAAGGGG - Intergenic
909225122 1:73010214-73010236 TCAATTACATGCAAATTAAGAGG - Intergenic
909367201 1:74840425-74840447 TTAATTAAATACAAATAAAGTGG + Intergenic
909412569 1:75372352-75372374 ACACTTACATGCAGATTGAGAGG + Intronic
909748845 1:79134024-79134046 TTAATTATGTGCAAATTAAGGGG + Intergenic
909899069 1:81109976-81109998 TCAATGAGATGTAAATTAAAGGG - Intergenic
910034565 1:82775774-82775796 TTAATTACATGCAAATTAGGGGG - Intergenic
910035458 1:82782695-82782717 TTAATTACATGCAAATTAGGGGG - Intergenic
910309794 1:85810368-85810390 TTAATTATATGCTAAATAAGGGG - Intronic
910479045 1:87638592-87638614 TTAAGTATATGCAAATTAAGGGG - Intergenic
910523991 1:88156436-88156458 TAAATCACATGCTCATTAAGTGG - Intergenic
910954668 1:92689111-92689133 TCAAGGAAATGTAAATTAAGTGG + Intronic
911409802 1:97488835-97488857 TTGATTACATCCAAATTAAGTGG - Intronic
911609667 1:99946779-99946801 TCAATTACCTGCAATTTACAAGG + Intergenic
911732327 1:101304156-101304178 TTAATTACATGCAAATGAAGGGG - Intergenic
911937954 1:104004708-104004730 TTAATTATATGCAAATCAAGAGG - Intergenic
911938774 1:104015355-104015377 GCAACTACATGCAAATAAATTGG - Intergenic
911975812 1:104493316-104493338 GCAATTACATGCCAATAAATTGG + Intergenic
912069972 1:105796817-105796839 TTAATCACATGCAAATTCATGGG + Intergenic
912118191 1:106434179-106434201 TAAATAGCATGCAGATTAAGGGG - Intergenic
912378757 1:109235001-109235023 TCAAAGAAATGTAAATTAAGAGG - Intronic
912971403 1:114287053-114287075 TCAATTATATGCAAAGTAAGAGG + Intergenic
913232201 1:116749393-116749415 TTAATTATATGCAAATTAAAGGG + Intergenic
913658186 1:120981813-120981835 TTAATTACATGCCAATTAAGAGG + Intergenic
913717421 1:121550866-121550888 TTAATTATGTGCAAATTAAGGGG + Intergenic
914009542 1:143764882-143764904 TTAATTACATGCCAATTAAGAGG + Intergenic
914450377 1:147786393-147786415 TTAATTACATACAAATTAAGGGG + Intergenic
914522754 1:148433078-148433100 TTAATTGCATGCCAATTAAGAGG + Intergenic
914648167 1:149673557-149673579 TTAATTACATGCCAATTAAGAGG + Intergenic
914938370 1:152000581-152000603 TTAATTGCATGCAGATTAAGGGG + Intergenic
914982358 1:152425938-152425960 TTAATGACATGCTAATTAAGGGG - Intergenic
915259311 1:154664941-154664963 TTAATTACATGCAAATTAAGGGG - Intergenic
915710620 1:157894694-157894716 TTAGTTATATGCAAATTAAGGGG - Intronic
915710714 1:157895596-157895618 TTAATCACATGCAAATTAAGGGG - Intronic
916005804 1:160658946-160658968 CTAATTATATGCAAATTAAGGGG + Intergenic
916241677 1:162646521-162646543 TCAATCACATGACAAGTAAGTGG + Intronic
916443726 1:164852924-164852946 TCAATTGCATGGAAAATTAGGGG + Intronic
916648146 1:166809230-166809252 TCAATTATATGCAAATTAAGTGG - Intergenic
916929664 1:169562455-169562477 TCAATTACATTAAAAGTAAATGG - Intronic
917204615 1:172559655-172559677 TTAATTATATGCAAATTAAAGGG + Intronic
917205498 1:172566663-172566685 TTAATTATATGCAAATTAAGGGG + Intronic
917509891 1:175661376-175661398 TCAATTACATCAACATTTAGGGG - Intronic
918420660 1:184361328-184361350 TTAATTACATGCAAATTAAGGGG + Intergenic
918598340 1:186320267-186320289 CCAAATACATACAAATTCAGGGG + Intronic
918682501 1:187372737-187372759 TCAACTACATGCAAATTGTGGGG + Intergenic
918755322 1:188333545-188333567 CCAATTACATGCCAATAAATTGG - Intergenic
919085863 1:192919459-192919481 TTAATTCCATGCAAATTAAGGGG + Intergenic
919139707 1:193555766-193555788 TTAATAATATGCAAAGTAAGGGG - Intergenic
919180588 1:194076295-194076317 TTAATTACATGCAGATTAATGGG - Intergenic
919365815 1:196659583-196659605 TTAATTATATGGAAATTAAGAGG + Intronic
919401046 1:197117376-197117398 TCCTTTACATGCCAACTAAGTGG + Intronic
920063423 1:203245853-203245875 ATAATTATATGCAAATTAAGGGG + Intronic
920606760 1:207396438-207396460 TTAATTATATGCAAATTAAAGGG + Intergenic
920636742 1:207711604-207711626 CCAATTACAGGTAAGTTAAGGGG - Intronic
921073866 1:211684368-211684390 TTAACTGCATGCAGATTAAGGGG + Intergenic
921387252 1:214582574-214582596 TAATTTACATGCAAACTAAGAGG + Intergenic
921690044 1:218138403-218138425 TTAATTACATGTAGATCAAGGGG + Intergenic
921802404 1:219416595-219416617 TTAATTGTATGCAAATTAAGAGG + Intergenic
922221445 1:223611434-223611456 TTAATTATATGCAAATTAAGGGG - Intronic
922459962 1:225808438-225808460 TTAGTTACATGCAGATTAAGGGG + Intergenic
922538502 1:226401415-226401437 TTAATTATATGCAAATTAAGGGG + Intronic
923202461 1:231725512-231725534 TCAATTACAGGCAAATTAAGGGG - Intronic
923203073 1:231731354-231731376 TTAATTACATGCAAATTAAGAGG + Intronic
923294440 1:232580081-232580103 TTGATTACATGCTAAATAAGGGG + Intergenic
923459513 1:234196273-234196295 TTAATTACATGCAAATTAAGGGG - Intronic
923995894 1:239494070-239494092 TTAATTACATGTAAATTCAAAGG + Intronic
924001309 1:239555652-239555674 TTAATTGCATGCAGATTAAGGGG - Intronic
924273052 1:242354326-242354348 TCAATTATAGGAAAATTAAGGGG - Intronic
924279002 1:242417465-242417487 TTAATTACATGCAAACTAAGGGG - Intronic
924596303 1:245447800-245447822 TTAATTACATGTAGATTAAGGGG - Intronic
924657101 1:245982628-245982650 TGAATTAAATACAAATTAAGTGG - Intronic
1063437258 10:6044413-6044435 TTAATTACACGCAGTTTAAGGGG + Intronic
1063533850 10:6863421-6863443 TTACATACATGCAAATTAAGGGG + Intergenic
1063800321 10:9569956-9569978 TAAATTAAATGCAATTTAAAAGG - Intergenic
1063925779 10:10975926-10975948 TCAATTACATGCAAATTAAGGGG + Intergenic
1064461717 10:15541034-15541056 TCAATTATATGCAACTTAAGGGG - Intronic
1064480624 10:15736915-15736937 TCAAATACATGCAAATAAGTAGG + Intergenic
1064607355 10:17057283-17057305 ACACCCACATGCAAATTAAGGGG + Intronic
1064647353 10:17473101-17473123 TCAGTTACATGCAAATTGAGGGG - Intergenic
1064655337 10:17550657-17550679 TTAATTACATTCAAATTAAGGGG + Intergenic
1064689140 10:17895921-17895943 TTAATTACATGCAAATGAAGGGG + Intronic
1064740105 10:18424346-18424368 TCAATTGCATGCAGATTAAGGGG + Intronic
1064862763 10:19845748-19845770 TTAATTACATGCAAATCAGGAGG + Intronic
1066097836 10:32089538-32089560 CCAATAACATTCAAATTGAGAGG - Intergenic
1066335536 10:34473807-34473829 TTAATTACATGCAGATTAAGGGG - Intronic
1066711660 10:38242333-38242355 TCAATTATAGGAAAATTAAGGGG + Intergenic
1067537052 10:47119355-47119377 TCAAATATATGAAAATCAAGAGG - Intergenic
1068208755 10:53892433-53892455 TAAATTACATTCAAATTAATAGG + Intronic
1068378611 10:56216954-56216976 TTAATTATATGCAAATTAAGAGG - Intergenic
1068657270 10:59588565-59588587 TCAATTACACACAAATTAAGGGG + Intergenic
1068691508 10:59920452-59920474 TTAATTATATGCAAATTAAGGGG + Intergenic
1068739016 10:60447845-60447867 TCACTTACCTAAAAATTAAGGGG + Intronic
1069048184 10:63764880-63764902 TTAATTGCATGCAGATTAAGGGG + Intergenic
1069670943 10:70203291-70203313 TGAATTACCTGAAAATTAACAGG + Intronic
1070184889 10:74052011-74052033 TTAATTATATTCTAATTAAGGGG + Intronic
1070196299 10:74160325-74160347 TTAATTATATACAAATTAAGAGG - Intronic
1070450752 10:76554743-76554765 TCACTTACATGCAACTTGAATGG - Intronic
1070501883 10:77080236-77080258 TTAATTGCATGCAGATTAAGGGG - Intronic
1071777426 10:88804771-88804793 TTAATTTCATGCAAATTAAGGGG - Intronic
1071946549 10:90652286-90652308 TTAATTATATGCAAATTAAAGGG - Intergenic
1072150535 10:92679415-92679437 TGAAAAACATGCAAATTAAGAGG + Intergenic
1072264284 10:93712690-93712712 TTAATTACATGCAAATTAAGGGG - Intergenic
1072355885 10:94610161-94610183 TCAATCTCATGGAAATTATGAGG - Intronic
1072526851 10:96279429-96279451 TTAATTAGATGCAAATTAAGGGG - Intergenic
1072887878 10:99296457-99296479 TTAATTGCATGTAGATTAAGGGG - Intergenic
1072888950 10:99304325-99304347 TTAATTGCATGCAGATTAAGGGG - Intergenic
1073127228 10:101158911-101158933 TTAACTATATGCAAATTAAGTGG - Intergenic
1073351729 10:102824775-102824797 TTAATTATATGCAAATTAAGGGG - Intergenic
1073355104 10:102847712-102847734 TTAATTATATGCAAATTAAGGGG + Intergenic
1073793321 10:106961790-106961812 TTAATAACTTGCAAATTATGGGG - Intronic
1073797908 10:107008096-107008118 TCAATTAGATTCAAAATGAGAGG + Intronic
1073936119 10:108634386-108634408 TTAATAACATGCTAATTAAGGGG + Intergenic
1073963907 10:108966238-108966260 TCATTTACATCCTAATTAACTGG + Intergenic
1074074963 10:110114745-110114767 GCAATAACATGAAAATTAAAAGG - Intronic
1074731664 10:116384337-116384359 TCTATTAAATGTAGATTAAGAGG - Intergenic
1075213024 10:120507802-120507824 TTAATTACAAGCTAATTCAGTGG + Intronic
1075363627 10:121862918-121862940 TTAATTGCATGCAAATTAAAGGG - Intronic
1076083911 10:127608102-127608124 TTAATTACATGCTAATTAAGTGG + Intergenic
1076200555 10:128554421-128554443 TCAGTTACATGCAAGTTAAGGGG + Intergenic
1076824985 10:132962419-132962441 TTAATCGCATGCAGATTAAGGGG - Intergenic
1077039517 11:512999-513021 TTAATTTCATGTAGATTAAGGGG - Intergenic
1077983109 11:7321742-7321764 CCAATTACATACAAATTAAAGGG + Intronic
1078074453 11:8145434-8145456 TGAAGAACATGCAAATTGAGGGG - Intronic
1078489086 11:11752714-11752736 TAAATTATATGCTAATTAATGGG + Intergenic
1078628667 11:12981964-12981986 TGAATTGCATACAAATTTAGTGG + Intergenic
1078982572 11:16553347-16553369 TCAATTATATGCAAATTAAGGGG + Intronic
1079064019 11:17274240-17274262 TTAAGTATATGCAAATTAATGGG - Intronic
1080463197 11:32473582-32473604 ACAATTACATGCAAATTAAGGGG - Intergenic
1080650285 11:34217032-34217054 TTAATTATATGCAAATTAAGGGG - Intronic
1080996972 11:37615585-37615607 TGAATTACAACCTAATTAAGTGG + Intergenic
1081305307 11:41504531-41504553 TCAATTATATGTTAATAAAGCGG - Intergenic
1081842711 11:46214895-46214917 TTAATTATATACAAATTAAGGGG - Intergenic
1082898512 11:58219550-58219572 TCAATTTAATGCTAATTAAGGGG - Intergenic
1083361967 11:62115390-62115412 TTGTTTATATGCAAATTAAGGGG - Intergenic
1083699085 11:64462695-64462717 TTAATTGCATGCAGATTAAGGGG + Intergenic
1083700335 11:64473245-64473267 TCAATTGCATGCAAATTAAGGGG - Intergenic
1083787449 11:64959862-64959884 CCAATTACAAGCCAATTAGGAGG + Intronic
1083908219 11:65688132-65688154 TTAATTATATGCAAATTAAGGGG - Intergenic
1083982422 11:66183811-66183833 TTAATTACATGCAAATTAAGAGG + Intronic
1084186157 11:67472961-67472983 TTAATTACATGCAAATTGAGGGG + Intergenic
1084240798 11:67818356-67818378 TTAATTGCATGCAGATTAAAGGG + Intergenic
1084386118 11:68843641-68843663 TCAAAGAAATGCAAATTAAAAGG - Intronic
1084406226 11:68975226-68975248 TCAATTATATGCAAGTTAAGGGG - Intergenic
1084731828 11:71078784-71078806 TTAATTACATGCAAATTATGGGG - Intronic
1084831642 11:71774356-71774378 TTAATTACATGCAGATTAAACGG - Intergenic
1085865143 11:80282171-80282193 TTAATTACATGTAGATTAAGGGG + Intergenic
1086169666 11:83821776-83821798 TCATATACATGTATATTAAGTGG - Intronic
1086376335 11:86204517-86204539 TCTATTCCATGCATATTATGGGG - Intergenic
1086553958 11:88087634-88087656 TAAATTGCATGCACATTAAGGGG + Intergenic
1086554422 11:88091906-88091928 TCAATTACATGCAAATGAAGAGG + Intergenic
1086978845 11:93170918-93170940 TCAATTTCATGTAGACTAAGGGG + Intronic
1087021541 11:93608200-93608222 TCAATTATATGCCAATTCATAGG - Intergenic
1087963777 11:104386838-104386860 TAAATTTCCTGCAAATTAAAGGG + Intergenic
1088116610 11:106319762-106319784 TTAATTACATGCAAATTAAGAGG - Intergenic
1088181472 11:107117436-107117458 TTAATTACATGCAAATTAAGGGG + Intergenic
1088188509 11:107200228-107200250 TCAATTATCTGCATGTTAAGTGG - Intergenic
1088263755 11:107970352-107970374 TTAATTACATGCAAATTAAGGGG - Intergenic
1088380193 11:109184348-109184370 TCAATTACATGTAAATTAAGGGG + Intergenic
1088566156 11:111175232-111175254 TTAATTACATGTAGATTAAGGGG + Intergenic
1088670140 11:112132628-112132650 TTAATTATATGCTAAATAAGAGG + Intronic
1089824752 11:121265083-121265105 TTAATAACATTCAGATTAAGGGG - Intergenic
1090141271 11:124266146-124266168 TCAATTACATGAAAGAAAAGGGG - Intergenic
1090458879 11:126872314-126872336 TTATTTACATGCAAATTAAGAGG - Intronic
1090713841 11:129412580-129412602 TTAATTATATGCAAATTAAGGGG + Intronic
1091467090 12:694243-694265 TTAATTATATGCAAATTAAGGGG - Intergenic
1091579864 12:1778070-1778092 TCAAATACATGAAAATAAAAAGG - Intronic
1092411028 12:8252930-8252952 TTAATTGCATGCAGATTAAAGGG + Intergenic
1092520670 12:9269505-9269527 TTAGTTACATGGAAATTAAGAGG - Intergenic
1093380022 12:18480737-18480759 TTAATTATACGCAAATTCAGGGG - Intronic
1093820159 12:23606001-23606023 TCAATTACATAAACATTAAAAGG + Intronic
1094440848 12:30474726-30474748 GCAATTACATGCCAATAAATTGG + Intergenic
1094450469 12:30578317-30578339 TTAATTATATGTAAATTAAGGGG - Intergenic
1094581444 12:31737428-31737450 CTAATTACATGCAAATCAAGGGG + Intergenic
1094709791 12:32950090-32950112 TTAATTGTATGCAGATTAAGGGG - Intergenic
1095329732 12:40944421-40944443 TCAATTGTATTAAAATTAAGGGG - Intronic
1096017049 12:48286113-48286135 TCAATTACATGCAAATTAAGGGG + Intergenic
1096262556 12:50102237-50102259 TCATTTACATGGGAATAAAGAGG - Intergenic
1096875322 12:54625596-54625618 TAAATTATATACAAATTAATGGG - Intergenic
1096971092 12:55666977-55666999 TTAACTGCATGCAGATTAAGGGG - Intergenic
1097146687 12:56945009-56945031 GCAATTATATGCAAATAAATTGG - Intergenic
1097580115 12:61444436-61444458 TTAATTATATGCTAAATAAGGGG - Intergenic
1097878469 12:64665683-64665705 TTAATTACATGCAAATTAAGAGG - Intronic
1098735280 12:74094003-74094025 TTAATTACATGCAAACTACAAGG - Intergenic
1098898908 12:76092643-76092665 TTAATTATATGTAAATTAAGAGG - Intergenic
1098926341 12:76354031-76354053 TTAATTACATACAAATTGATTGG - Exonic
1099529686 12:83762731-83762753 TTAATTGCATGCAGATTAAGGGG - Intergenic
1099562488 12:84195386-84195408 TCAGTTACATGCAAATAAAGGGG - Intergenic
1099625844 12:85072501-85072523 TCAATAACAAGCAAATTCACAGG - Intronic
1099839132 12:87943952-87943974 TCAGTTACATGCAAATTAAGGGG + Intergenic
1099869760 12:88332086-88332108 TTAATTATATGCAAACTAACGGG + Intergenic
1100312499 12:93409963-93409985 TCCATTAAATGCAAACAAAGAGG + Exonic
1101147081 12:101851306-101851328 TTAATTACTTGCAAATTAAGGGG + Intergenic
1101354296 12:103962693-103962715 CTAATTATATGCAAATCAAGGGG - Intronic
1101397536 12:104361659-104361681 TTTATTACATGCAAATTAAGAGG - Intergenic
1101796058 12:107975333-107975355 TTAATTATATGCAAATTAAGGGG + Intergenic
1102197800 12:111036709-111036731 TCATTTACATCGATATTAAGTGG + Intronic
1102448996 12:113026534-113026556 TTAATTATATGCAAATTAAGGGG + Intergenic
1102449745 12:113032525-113032547 CTAATTATATGAAAATTAAGGGG - Intergenic
1102816164 12:115868169-115868191 TATATTATATGCAAATTAAGGGG - Intergenic
1102883767 12:116506538-116506560 TAAATTGCATGCAGATTAAGGGG - Intergenic
1102905683 12:116673639-116673661 TTAATTACATGTAGATTAAGGGG + Intergenic
1102921916 12:116797813-116797835 TTAATTACATGTAGATTAAGGGG + Intronic
1103233904 12:119355759-119355781 TTAATTATATGCAAATTAAGGGG + Intronic
1103247090 12:119467046-119467068 TTAATTACATGTAGAATAAGCGG - Intronic
1103265642 12:119627980-119628002 TTAACTATATGTAAATTAAGGGG - Intronic
1103458407 12:121085372-121085394 TTAATTATATGCCAATTAAGGGG - Intergenic
1103460691 12:121102405-121102427 TTAATTATATGCAAATTAAGAGG + Intergenic
1103879004 12:124151673-124151695 TCAATAACATGCAAATTAAGGGG + Intronic
1104345381 12:127991815-127991837 TTAATTATATGCAAATTAAGGGG - Intergenic
1104434290 12:128743428-128743450 TTAATTATGTGCAAATTAAGGGG - Intergenic
1104561148 12:129845915-129845937 TTAATTACATGCAAATTAAGGGG + Intronic
1104621120 12:130313552-130313574 TTAATTACATGAAAATAAAGGGG - Intergenic
1104646530 12:130501631-130501653 TTAATTACATGCAAATTAAGGGG - Intronic
1105381709 13:19893242-19893264 TCAAGAACAGGCAAATTCAGAGG - Intergenic
1105672024 13:22629680-22629702 TTAATTATATGTTAATTAAGAGG - Intergenic
1105706831 13:22972404-22972426 TTAATTGCATTCAGATTAAGGGG - Intergenic
1105796257 13:23856489-23856511 TTATTTAAATGCAAATTAAGGGG + Intronic
1106439639 13:29754697-29754719 TTAATTATATGCAAATGATGGGG - Intergenic
1106773870 13:32989896-32989918 TCAATTACTTTCAAATAAAGAGG - Intergenic
1107602169 13:42024730-42024752 TTAATTGCATGTACATTAAGGGG + Intergenic
1108048454 13:46405743-46405765 TCAATTATATGCAAATTAAGAGG - Intronic
1108096957 13:46912512-46912534 CTAATTACATGCAGATTAAGGGG + Intergenic
1109192977 13:59347116-59347138 GTAATTACATGTAAATTAAAGGG + Intergenic
1109347475 13:61132361-61132383 TCACTTAGATGCAAATCAAATGG - Intergenic
1109379126 13:61535462-61535484 TTAATTATGTGCTAATTAAGTGG - Intergenic
1109419012 13:62085414-62085436 TTAATAACATGCAGATTAAGAGG - Intergenic
1109800291 13:67368684-67368706 TTAAATCCACGCAAATTAAGTGG + Intergenic
1110149527 13:72233596-72233618 TTAAGTACATACAAAGTAAGTGG - Intergenic
1110497056 13:76180370-76180392 TCAATTACATGTAAATTAAGGGG - Intergenic
1110823659 13:79946248-79946270 TGAATTATATGCAAATCTAGAGG + Intergenic
1111179596 13:84645761-84645783 TCCGTTTCATGCAAATTAAGGGG + Intergenic
1111431671 13:88153599-88153621 TTAATTGCATGCAGATTAAGTGG + Intergenic
1111450507 13:88408901-88408923 TTAATTACATGCAAATTAAAGGG + Intergenic
1111663841 13:91243213-91243235 CCAATTGCATGCAAATTAAGGGG + Intergenic
1111703078 13:91715029-91715051 CTAATTACATGCAGATTAAGGGG + Intronic
1111956622 13:94766101-94766123 TTAATTATGTGCAAACTAAGGGG - Intergenic
1112139710 13:96625125-96625147 TTAATTACGTGTGAATTAAGGGG + Intronic
1112582484 13:100688415-100688437 TCAAGCACATGCAAATTTAGGGG + Intergenic
1112591102 13:100763644-100763666 ATAATTACGTGCAAATTAATGGG - Intergenic
1112751482 13:102588309-102588331 ACAATTGCATGCAAATTAAGGGG + Intergenic
1112816360 13:103278362-103278384 TTAATTATATGCAAATTAAGAGG - Intergenic
1112966090 13:105196034-105196056 TCAATTACCTGCAAAATTAAGGG + Intergenic
1113315425 13:109174529-109174551 CCAATTTCATGGAAATCAAGAGG + Intronic
1113592151 13:111508521-111508543 TTAATTACATGCAGATTAAGTGG + Intergenic
1113752198 13:112784175-112784197 TTAATTGCATGCAGATTAAGGGG + Intronic
1114072365 14:19123472-19123494 GCAACTACATGCAAATTAGTTGG - Intergenic
1114089893 14:19276501-19276523 GCAACTACATGCAAATTAGTTGG + Intergenic
1114143687 14:19947672-19947694 TCATTTATATGCAAATTATCCGG + Intergenic
1115139328 14:30151121-30151143 TCAATTACATGCAAATTAAAGGG - Intronic
1115341930 14:32301916-32301938 TCAGTTACAAGCAAACTTAGAGG - Intergenic
1115734867 14:36315272-36315294 TGAATGACATGTTAATTAAGTGG - Intronic
1115759612 14:36566280-36566302 CAAATTAAATGCAAAGTAAGTGG + Intergenic
1115961901 14:38843589-38843611 TTAATTATATGCAGATTAAGAGG + Intergenic
1116140615 14:40989167-40989189 ACAAATACATGAAAATTAAATGG - Intergenic
1116259348 14:42602962-42602984 TTAATTACATGCATATTAAAGGG + Intergenic
1116287462 14:42990921-42990943 TTAATTACATGAAAATTAAGAGG - Intergenic
1116558054 14:46338192-46338214 TGAATTACATGCAAATTGAGGGG - Intergenic
1116593343 14:46808468-46808490 TCAAATACAGCCAGATTAAGAGG + Intergenic
1117128379 14:52657176-52657198 TTTATTATATGCAAATTATGAGG - Intronic
1117311393 14:54527020-54527042 TCTATAACAAGCAAATAAAGCGG - Intronic
1117880646 14:60310101-60310123 TTAATTATATGCAAATTAAGGGG + Intergenic
1118374797 14:65167362-65167384 TGAATTGTATGCAAATTAAGGGG - Intergenic
1118798973 14:69171875-69171897 TTAATTGCATGCAGATTAAGGGG - Intergenic
1119032703 14:71204983-71205005 TTAATAATATGCAAATTAAGGGG + Intergenic
1119381248 14:74230181-74230203 TAAATTGCATGCAAATTAAGGGG + Intergenic
1120124017 14:80719226-80719248 TCAATTACATGCAAATTAAGGGG - Intronic
1120260128 14:82173768-82173790 TTAATTACATGCAATTGAAGAGG - Intergenic
1120265204 14:82239899-82239921 TCAATTATATGTAAAATCAGTGG + Intergenic
1120328529 14:83058087-83058109 GCAATTACATCTAAATTAAGGGG - Intergenic
1120813734 14:88831323-88831345 TCAATTACATGCAAATTAAGGGG - Intronic
1121428248 14:93868714-93868736 TTAATTATATACAAATTAGGGGG + Intergenic
1121836886 14:97100386-97100408 TTAATTACATGTAGATTAAGTGG + Intergenic
1122002700 14:98674850-98674872 TTAGTTATATGCAAATTAAAGGG + Intergenic
1122436453 14:101704402-101704424 TTAATTATATGCAAATTAAGGGG - Intergenic
1122796326 14:104207934-104207956 TTAATGGCATGCAGATTAAGGGG - Intergenic
1122962343 14:105100982-105101004 TTAATTACATGCAAATTAAGGGG - Intergenic
1123176032 14:106420097-106420119 TCAATAAACTGCAAATTAAAAGG - Intergenic
1202841613 14_GL000009v2_random:126202-126224 TTAATGACATGCTAATTAAGGGG - Intergenic
1202911000 14_GL000194v1_random:116434-116456 TTAATGACATGCTAATTAAGGGG - Intergenic
1202881620 14_KI270722v1_random:66226-66248 TTAATGGCATGCTAATTAAGGGG + Intergenic
1202947651 14_KI270726v1_random:43465-43487 TCAATAAACTGCAAATTAAAAGG + Intergenic
1123822002 15:24040032-24040054 TCAATTACATGCAAATTGAGGGG - Intergenic
1123835203 15:24182957-24182979 TTAATTATATGCAAATTGAGGGG + Intergenic
1123849960 15:24344313-24344335 TTAATTACATGCAAATTGAGGGG + Intergenic
1123859615 15:24450728-24450750 TCAATTACATGTAAATTGAGGGG + Intergenic
1123870930 15:24571852-24571874 TTAATTATATGCAAATTGAGGGG + Intergenic
1124016703 15:25883087-25883109 TTAATCACAGGCAAATCAAGGGG - Intergenic
1125010139 15:34862895-34862917 GGAATTATATGCAAATGAAGGGG + Exonic
1125558206 15:40603843-40603865 TTAATTATATGCAAATTAAGAGG + Intronic
1126395749 15:48215252-48215274 TCAATCACATGCAGTTTAAAGGG - Intronic
1126515645 15:49533856-49533878 TCAATTACATTGAATTTAAATGG - Intronic
1128925776 15:71654268-71654290 TCAACTACGTGCCAATTCAGTGG - Intronic
1129147971 15:73666466-73666488 TTAATTACATGCAAATTAAGGGG + Intergenic
1129964701 15:79723859-79723881 TTAATCATATGAAAATTAAGGGG + Intergenic
1130324528 15:82869025-82869047 TTAATTACATGCAAATTAAGGGG - Intronic
1131347161 15:91660958-91660980 TTGATGATATGCAAATTAAGTGG - Intergenic
1131790924 15:95964852-95964874 TTAATTATATGCAAATTAAGAGG - Intergenic
1133165439 16:3943695-3943717 TTAATTACATGCAAATTAAGGGG + Intergenic
1133498760 16:6345361-6345383 TTAATTACATGGAAATTAAGGGG + Intronic
1133549302 16:6838481-6838503 TTAATTGCATGCAAATTAAGGGG - Intronic
1133716740 16:8457477-8457499 CTAATTATATGCAAATTAAGGGG - Intergenic
1133724367 16:8523635-8523657 TTAATTACATGCAAATGAAGAGG + Intergenic
1133962036 16:10503042-10503064 TCAATTATATGCTAAACAAGGGG - Intergenic
1134401451 16:13913986-13914008 TTCATTATATGAAAATTAAGTGG + Intergenic
1134749974 16:16618172-16618194 TTAATGATATGCAAATTAAGGGG + Intergenic
1134995502 16:18735443-18735465 TTAATGATATGCAAATTAAGGGG - Intergenic
1135056641 16:19237575-19237597 TTAATTACATGTAGATTAAAGGG - Intronic
1135416591 16:22273242-22273264 TTAATTGCATGCATATTAAGAGG + Intronic
1135491381 16:22912698-22912720 CTAATTACATGCAAATTAAGGGG + Intronic
1135534509 16:23282793-23282815 TTAATTACATACAAATCAAGAGG - Intronic
1135536492 16:23298432-23298454 TTAATGACATGCTAATTAAGGGG + Intronic
1135783436 16:25326507-25326529 TTAATTACATGCAAATCAAGGGG + Intergenic
1135793374 16:25419218-25419240 TTAATTGCATGAAGATTAAGAGG + Intergenic
1135833156 16:25796796-25796818 TTAATGACATGCTAATTAAGGGG + Intronic
1135980610 16:27143984-27144006 TTAATTAAATGCAAATTAAGGGG + Intergenic
1136177132 16:28524889-28524911 CTAATCACATGCTAATTAAGAGG - Intergenic
1136358472 16:29762098-29762120 TCAATCACATGCAAATTAAGGGG - Intergenic
1136614242 16:31386879-31386901 TTAATTACATGCAAATTAAGGGG - Intergenic
1136646917 16:31628766-31628788 TTCATTACATGCAAACTAAGGGG - Intergenic
1136658265 16:31727508-31727530 TTCATTACATGCAAACTAAGGGG + Intronic
1136689374 16:32017933-32017955 TTAATTGTATGCAAATTAAGGGG - Intergenic
1136789966 16:32961475-32961497 TTAATTGTATGCAAATTAAGGGG - Intergenic
1136879846 16:33892461-33892483 TTAATTGTATGCAAATTAAGGGG + Intergenic
1137772804 16:51030590-51030612 TTAATTATATGCAAAATAAGGGG + Intergenic
1137790549 16:51171271-51171293 TTAATTGCATGCAGATTAAGAGG + Intergenic
1138252457 16:55512604-55512626 TCATTTATATGCCAATTTAGGGG - Intronic
1138544962 16:57712286-57712308 TTAATCATATGCAAATTAAGGGG + Intronic
1138777432 16:59740894-59740916 TCAATTTTATGCAAATTAATGGG + Intronic
1138814324 16:60186824-60186846 TTAATTATACTCAAATTAAGGGG - Intergenic
1138850816 16:60627448-60627470 TTAATTGTACGCAAATTAAGGGG + Intergenic
1138851659 16:60636552-60636574 TCAATTATATGCTAAACAAGGGG - Intergenic
1138859288 16:60735928-60735950 TTAATTGCATGCAAATTAAGGGG - Intergenic
1138977535 16:62226029-62226051 TTAATTACATGCAAATTAAGAGG - Intergenic
1139102465 16:63785253-63785275 TAAATGACATGCAAATTAAGGGG + Intergenic
1139681757 16:68570461-68570483 TTAATTACATGCAAATCAAGGGG + Intronic
1139924027 16:70475838-70475860 CCAATCACATGCAAATCCAGGGG - Intronic
1139947163 16:70649301-70649323 TTAATTGCATGCAGATTAAGGGG + Intronic
1140494903 16:75376903-75376925 TTAATTACATGCAGATTAAGGGG - Intronic
1140543276 16:75780110-75780132 TTAATTGCATGCAGATTAAGGGG - Intergenic
1140838751 16:78819498-78819520 TTAATTATATGCAAATTAAGTGG - Intronic
1141354283 16:83329194-83329216 TGAATCCCATGCAAATTAAAGGG + Intronic
1141410945 16:83832735-83832757 TTAATTACATGCAAATTAAAGGG - Intergenic
1142158014 16:88541535-88541557 TCAATTACATGCAAATTAAAGGG + Intergenic
1142162612 16:88566449-88566471 TTAATTACATGCAGATTAAGGGG - Intergenic
1203092169 16_KI270728v1_random:1222938-1222960 TTAATTGTATGCAAATTAAGGGG - Intergenic
1143806743 17:9434804-9434826 TTAGTTGCATGCAAATGAAGAGG + Intronic
1143861563 17:9894984-9895006 TCAAGTACATGTAAATTCAAGGG - Intergenic
1143895769 17:10135143-10135165 TTAATTACATGTAGATTAAAGGG + Intronic
1144035730 17:11363864-11363886 TTAATTACATGCAAATTAAGGGG - Intronic
1144152719 17:12465657-12465679 TTAATTACATGCAAACTAACGGG - Intergenic
1144281097 17:13727267-13727289 TCATTTACATGCAAATGAAGGGG + Intergenic
1144303055 17:13941290-13941312 TCAATTACATGCAAATTAAGAGG + Intergenic
1144424859 17:15132305-15132327 TCAATTACATGCAAATTAAGGGG - Intergenic
1146087975 17:29847896-29847918 TCAATTACATGTAAATTAAGGGG - Intronic
1146480530 17:33201585-33201607 TTAATTACATGCAAATTAAAGGG - Intronic
1147152220 17:38524078-38524100 TTAATTGTATGCAAATTAAGGGG - Intergenic
1147431639 17:40375025-40375047 TTAGTTATATGCAAATTAAGGGG + Intergenic
1147445467 17:40472612-40472634 TTAAACACATGCAAATTAAGGGG + Intergenic
1147874089 17:43608444-43608466 TTAGTCATATGCAAATTAAGGGG + Intergenic
1147901095 17:43785367-43785389 TTAATTACATGTAGATTAAGGGG + Exonic
1148181170 17:45605989-45606011 TTAATTATATGCAAATTAAGGGG + Intergenic
1148267739 17:46239940-46239962 TTAATTACATGCAAATTAAGGGG - Intergenic
1148371426 17:47102555-47102577 TTAATTATATGCAAATTAAGGGG - Intergenic
1148641089 17:49188256-49188278 TCAATTACATGTCATTTAAAGGG + Intergenic
1148668664 17:49393761-49393783 TTAATTATATGCAAAATAAGGGG - Intronic
1149215093 17:54345305-54345327 TCGATTATATGCTAAATAAGGGG - Intergenic
1149239143 17:54628387-54628409 TCATTTTGATGCAAATTAAAAGG + Intergenic
1149669014 17:58388524-58388546 TCAAATACTTGCCAAGTAAGAGG - Intronic
1149706431 17:58698963-58698985 TCAATTACTTATAAATTAAATGG + Intronic
1149895783 17:60427240-60427262 TTAATTACTTGCAAATTATGGGG + Intronic
1150013080 17:61524603-61524625 TTAATTATATGCAAATTAAGGGG - Intergenic
1150062210 17:62078139-62078161 TTAATTACATGCAAATTAAAGGG - Intergenic
1150637890 17:66928993-66929015 TTAATTACATGCAAATTAAGGGG + Intergenic
1150727550 17:67663705-67663727 TTAATTATATGCAAATTAAGGGG + Intronic
1151013138 17:70525055-70525077 TTAATTACATGCAAATTAAGGGG - Intergenic
1151077710 17:71293342-71293364 TTAATTATGTGCAAATTAAGTGG - Intergenic
1151255868 17:72876004-72876026 TTAATTACATTTAGATTAAGGGG - Intronic
1151463729 17:74271358-74271380 TTAATTACATGCAAATTAAGAGG + Intergenic
1151905467 17:77045631-77045653 TCAATCACATGTCAGTTAAGGGG - Intergenic
1152009609 17:77703900-77703922 TCAATTACATGCAAATTAAGGGG + Intergenic
1152044488 17:77927045-77927067 TTAATTGCATGCAGATTAAGGGG + Intergenic
1152415840 17:80161242-80161264 TTAATTATATGCTAATCAAGGGG + Intergenic
1152736047 17:81997282-81997304 TCAACTACATGCACGTTAAGGGG + Intronic
1152803577 17:82343777-82343799 TTAACTACATGCAAATTAAGAGG - Intergenic
1152930389 17:83106351-83106373 TTAATGACATGCTAATTAGGGGG + Intergenic
1153023601 18:654734-654756 TCAATTACATGCAAATTAAGGGG + Intronic
1153129731 18:1841186-1841208 TTAATTATATGCAAATTAAGGGG - Intergenic
1154086232 18:11308154-11308176 TTAACTATATGCCAATTAAGAGG - Intergenic
1155088477 18:22482330-22482352 TTTAATATATGCAAATTAAGGGG - Intergenic
1155523938 18:26697541-26697563 TCAATTACATGCAAATTAGGGGG + Intergenic
1155592010 18:27437951-27437973 TCAATTATATACAAACTAAAAGG + Intergenic
1155630136 18:27883424-27883446 TTAAGTGCATGCAAATGAAGGGG + Intergenic
1155679940 18:28476213-28476235 TTAATTATATGCAAATTAATGGG - Intergenic
1155680882 18:28483958-28483980 TTAATTGTATACAAATTAAGGGG - Intergenic
1155764479 18:29610291-29610313 TTAATTATATGCTAATCAAGGGG - Intergenic
1155765702 18:29629711-29629733 TTAATTACATGCAGATTAAGGGG + Intergenic
1155870054 18:31016166-31016188 TTAATTATATGCTAAATAAGGGG - Intronic
1156160447 18:34351814-34351836 TTAATTACATGTAAATTAAGGGG - Intergenic
1156180749 18:34601240-34601262 TTAATTATAAGCAAATTAAGGGG + Intronic
1156310956 18:35921367-35921389 TCAATGACATGGAATTTCAGAGG + Intergenic
1156596092 18:38549982-38550004 TCAGATATATGAAAATTAAGAGG + Intergenic
1156645954 18:39162552-39162574 ATAATTACACACAAATTAAGGGG + Intergenic
1156825649 18:41427449-41427471 TTAATTACCTGCAAATTAGGGGG + Intergenic
1156988081 18:43372888-43372910 TTAATTACATGTATATTAAGGGG - Intergenic
1157030655 18:43903222-43903244 TTAATTATATGCAAACTAAGGGG + Intergenic
1157076304 18:44471405-44471427 TCAATTACATGCAAATTAAGAGG - Intergenic
1157131391 18:45010649-45010671 TCAGTTAGTTGTAAATTAAGAGG - Intronic
1157141569 18:45112945-45112967 ACAATTACATGCATATTCAATGG + Intergenic
1157746576 18:50141319-50141341 TTAATTACAGGTAAATTAAGGGG - Intronic
1157897065 18:51479254-51479276 TTAATTATATGCAAATTAAGGGG + Intergenic
1158979281 18:62743127-62743149 TCAATTATTTTTAAATTAAGGGG + Intronic
1159095833 18:63900570-63900592 TTAATTACATGTAGATTAAGGGG + Intronic
1159262933 18:66039361-66039383 TTAATTATATGCAAATTAAGGGG - Intergenic
1159310493 18:66701632-66701654 TTAATTACATGCAAATTAAGGGG - Intergenic
1159337063 18:67081976-67081998 TCAAATGCATGCAAATTGAGGGG - Intergenic
1159337073 18:67082049-67082071 TCAATTGCATGCAAATTGAGGGG - Intergenic
1159653337 18:71003329-71003351 TTAATTGCATGCAGGTTAAGGGG - Intergenic
1159897825 18:74013332-74013354 TCAATTACATGCAAATTAAGGGG + Intergenic
1160061437 18:75532408-75532430 ACAATTTCATGCACATCAAGGGG + Intergenic
1160062867 18:75548666-75548688 TCAATTACATGCAAATTAAGGGG - Intergenic
1160341630 18:78094291-78094313 TCAACTGCATGCAAATTAAGGGG + Intergenic
1161859986 19:6790766-6790788 TTAATTATATGCAAATCAAGGGG + Intronic
1161861777 19:6803272-6803294 TTAATTATATGCAAATTAAAGGG + Intronic
1161862027 19:6805043-6805065 TTAATTACATGTAGAGTAAGGGG + Intronic
1161970706 19:7578327-7578349 TTAATTGCATGCAAAGGAAGGGG + Intergenic
1162089562 19:8270130-8270152 TTAATCGCATGCAGATTAAGGGG - Intronic
1162219528 19:9164325-9164347 TTAATTACATGCAAATTAAGGGG + Intergenic
1162263778 19:9553200-9553222 TTAATTACATGTAGATTAAGGGG - Intergenic
1162293445 19:9796162-9796184 TTAATTACATGCAAATTAAGGGG + Intergenic
1162663020 19:12185126-12185148 TCAATTATATGCAAATTAAGTGG + Intronic
1162880436 19:13654818-13654840 TTAATTATGTGTAAATTAAGGGG + Intergenic
1162990759 19:14300609-14300631 TTAATTATATGCAAATTAAGGGG - Intergenic
1163265469 19:16218084-16218106 TTAATTATATGCAAATTAAGGGG - Intronic
1163567802 19:18061904-18061926 TTAATTGCATGCAGATTAAGGGG - Intronic
1163568314 19:18065028-18065050 TTAATTATATGCAAATGAAGGGG - Intronic
1164412122 19:28014774-28014796 TTAATCACATGTAGATTAAGGGG - Intergenic
1164433634 19:28209366-28209388 TTAATTCCATGCAAATTGAGGGG - Intergenic
1164561008 19:29292261-29292283 TTAATGACATGCAAATTAAGGGG + Intergenic
1164572510 19:29384741-29384763 TTAATTACATGCAGATTAAGGGG + Intergenic
1164779840 19:30883450-30883472 TTAATTACGTGCAAATTAAGGGG - Intergenic
1164855827 19:31519972-31519994 TTAATTACATGCAAATTAAGTGG + Intergenic
1164897518 19:31890218-31890240 TTAATTACATGCAGAGTAAGGGG + Intergenic
1164974106 19:32558908-32558930 TTAATTACATGCAAATTAAGGGG - Intergenic
1164976048 19:32573517-32573539 TTAATTATATGTAAATCAAGGGG - Intergenic
1165103143 19:33451007-33451029 TTAATTACATGCAGAGTAAGGGG - Intronic
1165187026 19:34031246-34031268 TTAATTATATGCAAATTGAGGGG - Intergenic
1165278615 19:34776849-34776871 TTAATTACATGCAGATTAAGGGG + Intergenic
1165285064 19:34834793-34834815 TTAATTGCATGCAGATTAAGGGG - Intergenic
1165367347 19:35376379-35376401 TTCATTACATGCAGATTAAGGGG - Intergenic
1165377691 19:35454682-35454704 TTAATTGCACACAAATTAAGGGG + Intergenic
1165876417 19:39010713-39010735 TTAAACACATGCAGATTAAGGGG - Intronic
1165881369 19:39046352-39046374 TCAGTTACATGCAAATTAGGGGG - Intergenic
1166584829 19:43936492-43936514 TTCATTACATGCAAATTAAGGGG - Intergenic
1166652589 19:44585742-44585764 TCACTTACATGCAAATTAAGGGG + Intergenic
1166955284 19:46460128-46460150 TTAATTATATGCAAATTAAGGGG + Intergenic
1166957250 19:46472740-46472762 TTAATGACGTGCTAATTAAGGGG + Intergenic
1167082937 19:47289718-47289740 TTAATTATATGCAAATCAAGGGG + Intergenic
1167091375 19:47346340-47346362 TTAATTACATGTAGATTAAGGGG - Intergenic
1167692423 19:50994643-50994665 TCAATTACATGCAAATTAAGGGG - Intergenic
1167819169 19:51910339-51910361 TTAATTATATGCAAAGTAAGGGG - Intronic
1167975911 19:53225857-53225879 TTAATTACATGCAAACTAAGGGG - Intergenic
1202657228 1_KI270708v1_random:35323-35345 TTAATGGCATGCTAATTAAGGGG + Intergenic
925027108 2:618744-618766 TTAATTGCATGCAGATTAAGGGG - Intergenic
926115745 2:10212149-10212171 TTAATTACATGCAAATTAAGAGG - Intergenic
926144632 2:10389233-10389255 TTAATTACATGCAAATTAGGGGG - Intronic
926207806 2:10846476-10846498 TCAACTACCTTCAAATTCAGAGG - Intergenic
926222597 2:10946057-10946079 TTACTTGCATGCATATTAAGGGG + Intergenic
926340880 2:11903370-11903392 TTAATTGCATGCAGATTAAAGGG - Intergenic
926412057 2:12614783-12614805 TTAATTATATGTGAATTAAGGGG + Intergenic
926438342 2:12860488-12860510 TTAAGTATATGCAAATTAAGGGG + Intergenic
926590079 2:14731265-14731287 TGTATTCAATGCAAATTAAGTGG + Intergenic
927231107 2:20825024-20825046 TTAATTACAGGCAAATTAAGGGG - Intergenic
927671106 2:25069644-25069666 TTAATTATATGCAGATTAAGGGG + Intronic
928038986 2:27854626-27854648 TAAATTATATGCTAATTAAGAGG - Intronic
928346567 2:30503034-30503056 TCAATTACATGCAAATTAAGGGG + Intronic
928634212 2:33226612-33226634 TTAATAATATGCTAATTAAGGGG + Intronic
928788148 2:34915536-34915558 CCAGTTACATGCAGATTAACGGG - Intergenic
928982310 2:37148784-37148806 TCAATTACATGCAAATTCTGGGG - Intronic
930117143 2:47727869-47727891 TCGATTACATGCTAAATAAGTGG + Intronic
930182654 2:48379531-48379553 TCAGATACATGTAAATTAATAGG - Intergenic
930863712 2:56102517-56102539 TCAATTACAAGCAAATTTAGGGG - Intergenic
930865144 2:56115353-56115375 TTAATTACATGCAGATTTAGGGG + Intergenic
930891181 2:56389711-56389733 TTAATTGCATGCAGATTAAGAGG + Intergenic
930903091 2:56532018-56532040 CCAATTACATGCAAATTAAGGGG + Intergenic
931072626 2:58670071-58670093 TTAATTACATGCAAATTAAGGGG + Intergenic
931972131 2:67600487-67600509 ATAATTACATACAAATTAAGGGG + Intergenic
932286174 2:70533786-70533808 GGAATTACAAGCAAATTAAGGGG + Intronic
932789873 2:74645660-74645682 TTAATTACATGCAAATTAAGGGG - Intronic
932811605 2:74831019-74831041 TAGTTAACATGCAAATTAAGGGG - Intergenic
932845709 2:75134096-75134118 TTAGTTACATGCTAAATAAGGGG - Intronic
932945758 2:76228435-76228457 TTAATTACATGTAAATTAGGGGG - Intergenic
933032841 2:77354032-77354054 TTAATTACATGCAAATTAAGGGG + Intronic
933351582 2:81159326-81159348 GGAATTAGATGAAAATTAAGAGG + Intergenic
933503554 2:83147417-83147439 TTAATTACATGTAGATTAAGGGG - Intergenic
933617849 2:84501799-84501821 CCAATTACATGCCAATAAATTGG - Intergenic
933941892 2:87251999-87252021 TTAATTACATGCAAGTTAAAAGG + Intergenic
934055554 2:88248529-88248551 TTAATTACATGCAGATTAAGGGG + Intergenic
934719929 2:96566818-96566840 TTAATTATATGCAAATTAAGGGG - Intergenic
934890432 2:98063618-98063640 TTAATTATATGCAAATTAAGGGG - Intergenic
935120319 2:100178415-100178437 TCAATTATATGCAAATTAAGGGG - Intergenic
935288436 2:101587856-101587878 TTAATTATGTGCAAATTAAGGGG + Intergenic
935571625 2:104668250-104668272 TCAAATACCTCCAAATTCAGAGG - Intergenic
935876613 2:107514623-107514645 TTAATTACATGAAAATTATCAGG - Intergenic
935895830 2:107736496-107736518 TTAATTACATGTTAATTTAGCGG - Intergenic
936338330 2:111609570-111609592 TTAATTACATGCAAGTTAAAAGG - Intergenic
936344936 2:111668272-111668294 TTAATTACATGCAAATTAAGGGG - Intergenic
937347613 2:121136311-121136333 TTAATTATATGCAAATTAACTGG + Intergenic
937396442 2:121540343-121540365 TCAAAAACAAGCAAATAAAGTGG + Intronic
937644613 2:124252255-124252277 TAAATTACGTGCCTATTAAGGGG - Intronic
937667845 2:124506999-124507021 TGAATTACAGACAAATTAACAGG + Intronic
938294158 2:130166964-130166986 TCAATGACATTCAAGTTAAAAGG + Intronic
938486605 2:131716956-131716978 GCAACTACACGCAAATTAATTGG - Intergenic
938710765 2:133974489-133974511 TTAATTATATGCTAAATAAGGGG + Intergenic
939455774 2:142432914-142432936 TCAAAGAAATGCAAATAAAGTGG + Intergenic
939733124 2:145810171-145810193 TGAATTACATGTAACTTTAGTGG + Intergenic
940122872 2:150287120-150287142 TGAATTATATGCAAATTAAAGGG + Intergenic
940612669 2:156010073-156010095 TCAATTCTATGGAATTTAAGAGG - Intergenic
940755774 2:157681227-157681249 TGAATTAAATTCAAAGTAAGTGG + Intergenic
941540288 2:166773648-166773670 TCTCTTACATGCACATTAATAGG + Intergenic
941714558 2:168749947-168749969 TTAATTACATTCACATTAAGGGG + Intronic
941735887 2:168976855-168976877 TAAGATACATGCAAACTAAGAGG - Intronic
941863305 2:170307801-170307823 TTAATTACATGCAAATTCAGAGG + Intronic
941994527 2:171589708-171589730 TCAATTACATTAAAATAAACAGG + Intergenic
942503580 2:176617944-176617966 TCAATTAAATGCAAACTTACTGG - Intergenic
942846543 2:180432834-180432856 TTAATGACATGCTAATTAAAGGG + Intergenic
943102333 2:183503173-183503195 TCAATAACATGCAATGTAAATGG - Intergenic
943128445 2:183826373-183826395 GTAATTACATGCATATTGAGAGG - Intergenic
943261170 2:185665549-185665571 TTAATTATATGCAAATTAGGGGG - Intergenic
943442906 2:187947971-187947993 TTAATTGCATGCAGATTCAGGGG - Intergenic
943469329 2:188274395-188274417 TTAATTACATGCAGACTAAGAGG - Intergenic
943473019 2:188318742-188318764 TTAATTACATGCAAATTAAGGGG - Intronic
943777325 2:191780437-191780459 TTAAATACTTGCTAATTAAGTGG - Intergenic
943868654 2:192962911-192962933 TTAATTATATGTAGATTAAGGGG + Intergenic
943883608 2:193181966-193181988 TTAATCACACGCAAATTAAGGGG - Intergenic
944205797 2:197157099-197157121 TCAATTATATTTCAATTAAGCGG + Intronic
944649665 2:201816933-201816955 TTAGTTATATGCAAATTAAGGGG - Intronic
944778628 2:202994893-202994915 TTAATTACATGCAAATTAAGGGG + Intronic
945321195 2:208425480-208425502 CCACTTATATGCAAATTAAGAGG - Intronic
945386763 2:209210041-209210063 TTAATTATATGCAAATTAAGGGG - Intergenic
945612973 2:212029129-212029151 TTAATTACATGCAGATTAAGGGG - Intronic
946058845 2:216924316-216924338 CTAATTATATGCAAACTAAGGGG - Intergenic
946805882 2:223471003-223471025 TTAATTACATGCAAATTACGGGG + Intergenic
946827300 2:223691867-223691889 TAAATGACTTGCAAATTCAGAGG - Intergenic
946928604 2:224650297-224650319 TTAATTATATGCAAATTAAGGGG - Intergenic
948107992 2:235430439-235430461 TTAATTACATGCAAATTAAGGGG + Intergenic
948254756 2:236558283-236558305 TTAATGACATGCTAATGAAGGGG + Intergenic
948420164 2:237854084-237854106 TCAGATACATCCAAATTAAGAGG - Intergenic
948529386 2:238594608-238594630 TTAATTATATGCTAAATAAGGGG - Intergenic
948557527 2:238823827-238823849 TTAATTACATACAAATTAAGGGG - Intergenic
948675884 2:239596399-239596421 TTAATTGCATGCAGATTAAGGGG + Intergenic
948880530 2:240855062-240855084 TTAGTGACATGCAAATGAAGGGG + Intergenic
1168884736 20:1240810-1240832 TTAATTGTATGCAGATTAAGGGG - Intronic
1168908281 20:1424106-1424128 TTAATTACATGCAAATTAAGAGG - Intergenic
1168909419 20:1435247-1435269 TTAATTACATGCAAATTAAGGGG - Intergenic
1169031958 20:2416518-2416540 TTAATTACATGCAAATTAAAGGG + Intronic
1169035417 20:2447171-2447193 ACAATTACATGCAAATTAAGGGG - Intergenic
1169271037 20:4199602-4199624 TTAACTACATGCAAATTAAGGGG + Intergenic
1169718899 20:8650423-8650445 TTAATCACATGTAGATTAAGGGG - Intronic
1169925947 20:10783996-10784018 TTAATTATATGCAAATTAAGGGG + Intergenic
1170216991 20:13901976-13901998 TTAATTACATATAGATTAAGGGG + Intronic
1170249189 20:14261020-14261042 TAAATTACATGCAAATCAGTAGG + Intronic
1170303014 20:14907212-14907234 TCAATTGTATGCAAATTAAGGGG - Intronic
1170461572 20:16581644-16581666 TTAATTATATGCAAATTAAGGGG + Intergenic
1170478786 20:16744428-16744450 TCGGTCACATGCAAATTAAGGGG + Intergenic
1170610779 20:17911101-17911123 TTAATTATATGCGAATGAAGGGG - Intergenic
1170753692 20:19176776-19176798 ATAATTACATGCAAATTAAAAGG - Intergenic
1171022189 20:21595837-21595859 TGAATCACATGCTAATTAAGAGG + Intergenic
1171171672 20:23020839-23020861 TCAATTATATGCTAAACAAGGGG - Intergenic
1171313945 20:24169575-24169597 TTAATTATATGCAAATTAAGGGG - Intergenic
1171325009 20:24283440-24283462 TCAACTACATGCAAATTAGGGGG + Intergenic
1172199235 20:33113558-33113580 TTAATTACATGCTAGTTAAGAGG + Intergenic
1172246778 20:33450863-33450885 TTAATTATACACAAATTAAGAGG + Intergenic
1172319621 20:33986197-33986219 TTAATTACATGCAAATTAAGGGG - Intergenic
1172514803 20:35525857-35525879 TTAACTACATGCAAATTAAGGGG + Intronic
1172570706 20:35968146-35968168 TCAATCACATGCAAATTAAGGGG + Intronic
1172582892 20:36062604-36062626 TTATTTACATGCAAATTCAGGGG - Intergenic
1172937077 20:38628122-38628144 TTAATTACATGCAAATTAAGGGG + Intronic
1173466377 20:43285258-43285280 TCAGTTATACGCAAATTGAGGGG + Intergenic
1173486386 20:43444399-43444421 TTAATTACATGCAAATTAAGGGG - Intergenic
1173526514 20:43737061-43737083 TTAATTGCATGCAGATAAAGGGG - Intergenic
1173887009 20:46468596-46468618 TTAAATATATGCAAATTAACAGG + Intergenic
1173900023 20:46580956-46580978 TTAATTATATGCAAATTAAGGGG - Intronic
1174140785 20:48412260-48412282 TTAATTATATGCTAATTAAGGGG - Intergenic
1174431186 20:50470517-50470539 TTAATTATATGCTAATGAAGGGG + Intergenic
1174894797 20:54436928-54436950 TTAATTGCATGCAGATTAAGGGG + Intergenic
1174949320 20:55027373-55027395 TTACTGACATGCTAATTAAGGGG + Intergenic
1175138123 20:56840190-56840212 TTAATTAAATGCAAATTAAGGGG + Intergenic
1175138253 20:56841037-56841059 TTAATTGCATGCAGATTAAGGGG - Intergenic
1175477300 20:59285950-59285972 TTAATTATATGCAAATTAAGGGG + Intergenic
1175509619 20:59515050-59515072 TTAATTACATGCAAAGTAAGGGG + Intergenic
1175675432 20:60942715-60942737 TTAATAACATGCAGATTAAGGGG - Intergenic
1175713826 20:61242275-61242297 TAAGTTACATGCAAATTAAGGGG + Intergenic
1176048122 20:63103016-63103038 TCAATTACGCCAAAATTAAGTGG - Intergenic
1176518027 21:7800893-7800915 TTAATTATATGCAAATTAAGGGG + Intergenic
1176597100 21:8757663-8757685 TTAATGGCATGCTAATTAAGGGG + Intergenic
1176630354 21:9131131-9131153 TTAATGACATGCTAATTAAGGGG - Intergenic
1176642916 21:9323608-9323630 TTAATGGCATGCTAATTAAGGGG + Intergenic
1177077125 21:16589627-16589649 TAAATTACATGTTTATTAAGTGG + Intergenic
1177095968 21:16833450-16833472 TCTGTTACATGCAAGTTAACAGG + Intergenic
1177348931 21:19910025-19910047 TTAATTACATGTAGAATAAGAGG + Intergenic
1177557853 21:22715112-22715134 TTAATCACGTGCAAATTAAGGGG - Intergenic
1177964358 21:27708883-27708905 GCAACTACATGCAAATAAATTGG - Intergenic
1178026798 21:28477655-28477677 TCAGTTACATGCAAATCAAGGGG - Intergenic
1178042343 21:28653023-28653045 TCAATTACATGCAAATTAAGGGG - Intergenic
1178063233 21:28874833-28874855 TCAATTATATGCCAATTCATAGG - Exonic
1178174722 21:30083415-30083437 TTATTTATATGCAAATTAATGGG - Intergenic
1178404377 21:32312264-32312286 TAAAATATATGCAAATCAAGAGG + Exonic
1178652055 21:34430906-34430928 TTAATTATATGCAAATTAAGGGG + Intergenic
1178974642 21:37210334-37210356 TTAATTATATGTAAATTAAAGGG + Intergenic
1179317058 21:40253314-40253336 TCAAATACATGCAATTTATTTGG - Intronic
1179413549 21:41180115-41180137 TTAATTATATGCAAATGAAGGGG + Intronic
1179414430 21:41186828-41186850 TTAACTATATGCAAATTAATGGG + Intronic
1180370019 22:11975591-11975613 TTAATGGCATGCTAATTAAGGGG - Intergenic
1180376234 22:12096530-12096552 TTAATGGCATGCTAATTAAGGGG + Intergenic
1180421340 22:12817169-12817191 TTAATGGCATGCTAATTAAGGGG - Intergenic
1181753660 22:25007755-25007777 TTAATTACATGCAAGTCAAGGGG - Intronic
1181754920 22:25017000-25017022 TTAATTATATGCAAATTAAGGGG + Intronic
1181910018 22:26231197-26231219 TTAATTACATGCAAATTAAGGGG + Intronic
1182029598 22:27147471-27147493 TTAATTATATGCAAATTAAAGGG - Intergenic
1182186274 22:28405853-28405875 TTAATTACATGCAAATGAAGTGG - Intronic
1182192179 22:28473546-28473568 TTAATTATATGCAAATCAAGGGG - Intronic
1182553700 22:31117036-31117058 TCCATTAGATGTAAATGAAGAGG - Intronic
1182743794 22:32589011-32589033 TTAATTACATGCAAATTAAGAGG - Intronic
1182812047 22:33125005-33125027 CTAATGACATGCTAATTAAGAGG + Intergenic
1183042111 22:35189509-35189531 TCAATTATATGCTATTTATGAGG + Intergenic
1183111833 22:35655437-35655459 TCAATAATATGCAAATGAATTGG - Intronic
1183144812 22:35980585-35980607 TCAATTAGGTGAAAATTAAGCGG + Intronic
1183336453 22:37250204-37250226 TTAGTCACATGCAAATTAAGGGG - Intergenic
1183356012 22:37359934-37359956 TTCATCACATGCAAATTAAGGGG + Intergenic
1183560074 22:38565486-38565508 TTAATTACGTGCAAATTAAGGGG - Intronic
1183566919 22:38622143-38622165 TTAATTACAGGCAAATTAAGGGG - Intronic
1183660752 22:39219674-39219696 TTAATTATATGCAAATTACGGGG - Intergenic
1183676602 22:39302288-39302310 TTAATTATATGCAAATGAAGGGG - Intergenic
1184632476 22:45793997-45794019 TTAACTATATGCGAATTAAGGGG + Intronic
1184866909 22:47206468-47206490 TTAATTACATGTAAATTGAGGGG - Intergenic
1184964065 22:47954215-47954237 TTAATTATATGCAAATTAAGAGG + Intergenic
1185300061 22:50074879-50074901 TTAAGTATATGCTAATTAAGGGG - Intronic
949201372 3:1383798-1383820 CTAATTACATGCAAATTAATGGG + Intronic
949255094 3:2036373-2036395 TTAATTATATGCAAATTAAGGGG - Intergenic
949712284 3:6885336-6885358 TTAATTATATGCAAATTAAGGGG + Intronic
949997042 3:9626352-9626374 TCAATTACATAGAAAATAAGGGG + Intergenic
950072106 3:10161013-10161035 TTAATTATATGCAAATTAAGGGG + Intergenic
950402743 3:12782576-12782598 TCAATTATATGCTAAATAAGGGG + Intergenic
950513976 3:13451950-13451972 TAAAAGACATGCTAATTAAGAGG - Intergenic
950700435 3:14741834-14741856 TTAATTACATATAGATTAAGTGG + Intronic
950705275 3:14775611-14775633 TTAATTATATGCTAAATAAGGGG + Intergenic
950779378 3:15378202-15378224 TCAATTACTTGTATATTAAGGGG + Intergenic
951400548 3:22227800-22227822 TTAATTATATGTAAATTAATGGG - Intronic
951417642 3:22444685-22444707 ACATGTACATGCAAATGAAGTGG + Intergenic
951832880 3:26950088-26950110 TTAATTACATGCAAATTAAGGGG + Intergenic
952194369 3:31057431-31057453 TTAATTACATATACATTAAGGGG - Intergenic
953140179 3:40222235-40222257 TTAATTACATGTAAGTTAAGGGG + Intronic
953408192 3:42670682-42670704 TGACTTACATGCAAATTAAGGGG + Intergenic
953638651 3:44685327-44685349 TTAATCGCATGCAGATTAAGGGG - Intergenic
953638809 3:44686277-44686299 TTAATCGCATGCAGATTAAGGGG - Intergenic
953873136 3:46645002-46645024 TTAATTATATATAAATTAAGGGG + Intergenic
954049532 3:47962135-47962157 TTAATTACATGCTAATTAAGAGG - Intronic
954803498 3:53201359-53201381 TTAATTATATGCAAATTAAGGGG - Intergenic
955154384 3:56402251-56402273 TTAATTACATGCAAATTAAGGGG + Intronic
955560300 3:60182005-60182027 TTAATTATATGCTAAGTAAGAGG + Intronic
956120954 3:65965326-65965348 TTAATTACATGAAAATAAAGTGG - Intronic
956346516 3:68285684-68285706 TCAATCACATGCAATTTATGTGG + Intronic
956839257 3:73121822-73121844 TTATTTATATGCAAACTAAGAGG + Intergenic
957097164 3:75786960-75786982 TTAATGGCATGCTAATTAAGGGG - Intergenic
957100418 3:75819596-75819618 TCAATTACATTCAAGATAAAAGG - Intergenic
957968390 3:87351499-87351521 TAAATTACATGCAAATGAGCTGG + Intergenic
959061908 3:101623739-101623761 TTAATTATATGGAAATTAAGGGG + Intergenic
959129556 3:102337339-102337361 TTAATTACATGTACATTAAGAGG - Intronic
959266219 3:104142292-104142314 TTAATCAAATGCAAATTAAGGGG - Intergenic
959333038 3:105030596-105030618 TTAATTATATGCAAATTAAGGGG - Intergenic
959770634 3:110090891-110090913 ACCATTACATGCAAATTGAGGGG + Intergenic
959780538 3:110227621-110227643 TTAATTACATGCAAATTAAGGGG - Intergenic
959820441 3:110729353-110729375 TCACTTACATGAAAAGTAGGTGG - Intergenic
960858718 3:122129563-122129585 TTAATTACATGCAAATTAAGGGG + Intergenic
961298122 3:125903554-125903576 TTAATTGCATGCAGATTAAAGGG - Intergenic
961503575 3:127355287-127355309 TTAATTACATGCAAATTAAGGGG + Intergenic
961527230 3:127512898-127512920 TTAATTACATGCAAATTAAGGGG - Intergenic
961744938 3:129058680-129058702 TTCATTACATGCAAATTCAGGGG - Intergenic
962069579 3:132019420-132019442 TCAATTTGATTCAAATTAATAGG + Intronic
962260947 3:133905547-133905569 CTAATTGCATGCAGATTAAGGGG + Intergenic
962697400 3:137963626-137963648 TTAATTTCATGCAAATTACGGGG + Intergenic
963565278 3:146921718-146921740 TTAATTGTATGCTAATTAAGGGG - Intergenic
963775640 3:149436404-149436426 TTAATTATATGCAAAATAAGAGG - Intergenic
964015301 3:151938184-151938206 ATAATTACCTGCAAATTAAGAGG + Intergenic
964197300 3:154079524-154079546 TTAATTATGTGCAAATTAAGGGG + Intergenic
964274097 3:154990069-154990091 ACAAATACATGGAAATTAAAAGG + Intergenic
964835784 3:160936960-160936982 TCAATTAAACTAAAATTAAGAGG - Intronic
965043367 3:163541027-163541049 TCAGTTACAGGCAAATTTAGAGG - Intergenic
965048091 3:163605133-163605155 TCAATTAGCTGCAAATCAAAAGG + Intergenic
965912667 3:173799243-173799265 TAAATGTCATGCAAATTAAATGG + Intronic
965967484 3:174511634-174511656 ATAATTACATGGAAATTAAATGG - Intronic
966072563 3:175896446-175896468 TAAATTATATGCAAATTAAGGGG - Intergenic
967415425 3:189212187-189212209 TAAATTACATACAAACTAATGGG + Intronic
967620495 3:191627936-191627958 TTAATTACATACAAATTAAGGGG - Intergenic
967629356 3:191726333-191726355 GCAATGACATTCAAATTGAGTGG - Intergenic
967843609 3:194027271-194027293 TTAACTATATGCAAATTAAGGGG + Intergenic
1202743969 3_GL000221v1_random:81405-81427 TTAATGGCATGCTAATTAAGGGG - Intergenic
968600121 4:1504715-1504737 TTAATGATATGCAAATTAAGGGG + Intergenic
968999075 4:3965432-3965454 TTAATTGCATGCAGATTAAAGGG + Intergenic
969191523 4:5524925-5524947 TTAATTATATGCTAATTAAGAGG + Intronic
969218465 4:5742994-5743016 TCAATTACATGCAAATGAAAGGG + Intronic
969356839 4:6632930-6632952 TTAATTATGTGAAAATTAAGGGG + Intergenic
969359101 4:6650171-6650193 TTAATTACATGCAAATTAAGGGG - Intergenic
969698913 4:8754968-8754990 TTAATTATATGCAAATTAAAGGG - Intergenic
969754925 4:9143200-9143222 TTAATTGCATGCAGATTAAAGGG - Intergenic
969814827 4:9679483-9679505 TTAATTGCATGCAGATTAAAGGG - Intergenic
970073212 4:12186844-12186866 TTAATTGCATGCAAATTAAAGGG + Intergenic
970168965 4:13269739-13269761 TCCATTACTTGCCAATCAAGAGG + Intergenic
970431237 4:15990837-15990859 TCAATGGAATGCTAATTAAGTGG - Intronic
971276096 4:25198312-25198334 AGAATGACATGCAAAATAAGAGG + Intronic
971602856 4:28617882-28617904 TAAATCACATGCAAATTCATGGG - Intergenic
971911037 4:32798231-32798253 TTAATTACATGTAGATTAAGGGG - Intergenic
972413014 4:38811612-38811634 TTAATTGCATGCAGATTATGGGG - Intronic
972891407 4:43560507-43560529 TTAATTATATGCTAAATAAGTGG - Intergenic
973148511 4:46859833-46859855 TTAATTACATGCAAATTAAGGGG - Intronic
973360401 4:49159885-49159907 TTAATGGCATGCTAATTAAGGGG + Intergenic
973399687 4:49628024-49628046 TTAATGGCATGCTAATTAAGGGG - Intergenic
973655272 4:53041150-53041172 TCAATAATATGCTAATTAAAAGG + Intronic
973842544 4:54876728-54876750 TTAATTATGTGCAAATTAGGGGG + Intergenic
973881984 4:55281848-55281870 ACAATTACATCCCAATTAATAGG - Intergenic
974974767 4:68876932-68876954 AAAATTACATAAAAATTAAGAGG - Intergenic
974994396 4:69135698-69135720 AAAATTACATAAAAATTAAGTGG + Intronic
975093324 4:70428114-70428136 TTAATTGCATGCAGTTTAAGGGG - Intergenic
975481415 4:74884696-74884718 TTAAGTACATGCAAATTATGTGG + Intergenic
975596877 4:76055736-76055758 TCAATGAAATGTAAATTAAATGG - Intronic
975966307 4:79976555-79976577 TTAATTATATGAAAATTAAGGGG - Intronic
976013727 4:80524297-80524319 TCACCTACATACAAATTAAGGGG + Intronic
976090248 4:81449698-81449720 TTAATTATCTGAAAATTAAGTGG + Intronic
976128752 4:81861154-81861176 GCAACTACATGCCAATAAAGTGG + Intronic
976208292 4:82642384-82642406 TCAAATATATGCAACTTATGGGG - Intronic
976643087 4:87359856-87359878 TTAACTCCAAGCAAATTAAGAGG + Intronic
977825273 4:101523941-101523963 TCAATCACATACAAATTAAGAGG - Intronic
978020552 4:103805635-103805657 TAACTTATATGCAAATTCAGGGG - Intergenic
978905397 4:113999379-113999401 TCAAATACATGTAAGTTAATTGG - Intergenic
978966128 4:114743962-114743984 TCAACTCCATGCAAAATTAGGGG + Intergenic
979511219 4:121556062-121556084 TTAATTACATGCAAATTAAGGGG - Intergenic
979647894 4:123093310-123093332 TCATTTACATGCAAATTAAAGGG + Intronic
980592802 4:134913634-134913656 TTTATTACCTGCAAATTAACTGG + Intergenic
980644865 4:135630640-135630662 GCAAATACATGGAAATTAAATGG - Intergenic
981072320 4:140556831-140556853 TCTTTTTCATGCAAAGTAAGTGG - Intergenic
981916528 4:150039908-150039930 TTAATGACATGCTAATTATGGGG + Intergenic
982652446 4:158103173-158103195 TTAATTATGTGCAAATTAAGGGG + Intergenic
982893538 4:160886722-160886744 TCAATGACATGCCAAAGAAGAGG + Intergenic
983676819 4:170304584-170304606 TCAATTACATGCACATCCTGAGG - Intergenic
983995353 4:174175519-174175541 TTAATTATATGCAAAACAAGGGG + Intergenic
984197537 4:176676952-176676974 TTAATTACGTGCAAATAAAGGGG - Intergenic
984203511 4:176757284-176757306 TCAATTACATGCCAATTGAATGG + Intronic
984330368 4:178307689-178307711 TTAAATAAATGCAAATTAAGAGG + Intergenic
984432302 4:179664716-179664738 TTAGTTACATGCAAATGAAGGGG - Intergenic
984926201 4:184809065-184809087 TCACTTTAATGAAAATTAAGTGG - Intronic
984938643 4:184912089-184912111 TCATTTACTTGCCCATTAAGGGG + Intergenic
985136651 4:186792962-186792984 TCAATTCTATGCAAACTCAGGGG + Intergenic
985220530 4:187698791-187698813 TCAGTTACCTGCAAAATGAGAGG + Intergenic
1202757833 4_GL000008v2_random:81970-81992 TTAATGGCATGCTAATTAAGGGG + Intergenic
985690905 5:1311734-1311756 TTAATTACATGTAGACTAAGGGG + Intergenic
985870670 5:2552990-2553012 TCAAGTACATTCAAATCAAATGG - Intergenic
986201806 5:5586037-5586059 TCAATTACCTGCAAATTAAATGG + Intergenic
986638985 5:9853373-9853395 TTAATTACATGCCAATTAAGGGG + Intergenic
987197726 5:15544044-15544066 TTAATTACATGCAAATTAAGGGG - Intronic
987671565 5:21016397-21016419 TTAACTATATGCGAATTAAGGGG + Intergenic
987819766 5:22947770-22947792 TTAATCACATGCAGATTAAGGGG - Intergenic
988226057 5:28412441-28412463 CCAATCATATGCAAATTAATGGG + Intergenic
988878204 5:35471662-35471684 TATATTACATAGAAATTAAGAGG + Intergenic
988936638 5:36090039-36090061 TCAATTACATGCAAATTAAGGGG + Intergenic
989311323 5:40022101-40022123 TCAATTGCATGCAAACTAAGAGG + Intergenic
989641129 5:43584441-43584463 TTAATTATATGCTAAATAAGGGG - Intergenic
989641918 5:43590858-43590880 TTAATTATATGCTAAATAAGGGG - Intergenic
990155955 5:52877594-52877616 TTAATCACATGTACATTAAGAGG - Intronic
990511382 5:56492400-56492422 TTAATTACATGTAGACTAAGGGG + Intergenic
990616004 5:57508964-57508986 TTAATTATATGCAAATTGATGGG - Intergenic
990762351 5:59143478-59143500 TCAAGGACATGCACAGTAAGCGG - Intronic
991004363 5:61813149-61813171 TTAATTTCATGCCAACTAAGGGG + Intergenic
991596250 5:68309535-68309557 TTATTTACATGCCAATTAATAGG - Intergenic
991944424 5:71885739-71885761 TTAATTACATGCAAATTAAGAGG + Intergenic
992508468 5:77410299-77410321 TTCATTACATGCAAATGAAGGGG + Intronic
992724309 5:79591148-79591170 TTAATGACATGCTAATTAAGGGG - Intergenic
993206778 5:84891684-84891706 ACAATTACATGCCAATAAATTGG - Intergenic
993298472 5:86175479-86175501 TTAGTTATATGCAAATTAAGAGG - Intergenic
993364035 5:87013749-87013771 TAAATTACAAGGAAATTAACAGG + Intergenic
993582593 5:89681342-89681364 GCAATTATATGCCAATAAAGTGG + Intergenic
993794688 5:92251950-92251972 ACAATTAAATGAAAATTAAACGG + Intergenic
994238286 5:97391307-97391329 TCAATTACATGCAAATTAAGGGG - Intergenic
994382521 5:99088158-99088180 TAAAATACGTGCAAATTCAGTGG - Intergenic
994593365 5:101800577-101800599 TCAAGGAAATGCAAATTAAATGG - Intergenic
994801288 5:104380423-104380445 TTAATTATATGCAAATTAAGAGG - Intergenic
994905526 5:105837755-105837777 TTAATTTTATGCAAATTAAGTGG - Intergenic
995199842 5:109413609-109413631 TTAATTATATGCTAATTAAGAGG + Intergenic
995296009 5:110523177-110523199 ACAATTACATGCCAATAAACTGG - Intronic
995840188 5:116436645-116436667 GTAATTGCATGCAGATTAAGGGG - Intergenic
995963386 5:117873096-117873118 TAAATTATATGCTAATTAAGGGG + Intergenic
996629057 5:125606074-125606096 TTAATTGTATGCAGATTAAGGGG - Intergenic
996988497 5:129598716-129598738 TCAATTACTTGAAAATTACTAGG - Intronic
997065230 5:130551725-130551747 CTAATTATATGCAAATTAATAGG - Intergenic
997065371 5:130553531-130553553 TCAATTGCATGCAAATTAAAAGG - Intergenic
997065449 5:130554206-130554228 TCACTTACAGGCAAATTAAGGGG - Intergenic
997070562 5:130617633-130617655 TTAACTACATGCAGATTAAGGGG - Intergenic
997222621 5:132181730-132181752 TTAATTACATGTAGATTAAGGGG + Intergenic
997514557 5:134477809-134477831 TTTATTAAATGCAAATTAAGGGG - Intergenic
998323083 5:141250963-141250985 TCACTTACATGCAAATTAAGAGG - Intergenic
998398367 5:141834405-141834427 TTTATCACATGCAAATTAGGTGG - Intergenic
998477686 5:142435411-142435433 TTAATAACATGCAGATTAAAGGG + Intergenic
998517270 5:142768021-142768043 TTAATTATATGCTAATTAAGAGG + Intergenic
998850606 5:146346993-146347015 TCAATTACAAGCAAATTGACAGG - Intergenic
999674692 5:153987296-153987318 TTAATTACCTGCAAATTAAGGGG + Intergenic
1000310971 5:160044425-160044447 TCAATTATATGCTAAGCAAGGGG + Intronic
1000520891 5:162293368-162293390 TTAATTACATGTAGATTAAAGGG - Intergenic
1000543563 5:162570504-162570526 TTAATTACATGCAAATTAAGGGG - Intergenic
1000646507 5:163766377-163766399 TTGATTATATGCAAATTAAAGGG + Intergenic
1000728899 5:164806050-164806072 CTAATTACGTGCAAATTAAGGGG + Intergenic
1000775133 5:165410255-165410277 CTAATTTCATGCATATTAAGGGG + Intergenic
1000827381 5:166062178-166062200 TCAATCCCATGCAAATGAAAAGG + Intergenic
1001917430 5:175573657-175573679 TCAATTACATCCCAATTTATGGG - Intergenic
1003043809 6:2714356-2714378 TCAATTACATGCAAATTAAGGGG - Intronic
1003510564 6:6776296-6776318 TTAATTATATGCTAAATAAGGGG + Intergenic
1003924234 6:10861875-10861897 TTAATTATATGCAAATTAAGGGG - Intronic
1004061265 6:12200301-12200323 TTAATTGCATACAGATTAAGGGG - Intergenic
1004232214 6:13843746-13843768 TTAATTGCATGCAGATTAGGGGG - Intergenic
1004641998 6:17524594-17524616 TTAATTATAGGCAAATTAAGGGG + Intronic
1004846101 6:19644171-19644193 GCAATTACATGCAAATTTGTCGG + Intergenic
1004961412 6:20793297-20793319 TCAATTATATGCAAAGGAAGAGG + Intronic
1005117371 6:22353698-22353720 ACAATCAAATGCAAATTCAGGGG - Intergenic
1005608594 6:27500701-27500723 TAAATTAAATTCAAAGTAAGTGG + Intergenic
1006234943 6:32621696-32621718 TTAATTATATGCAAATTAAGAGG + Intergenic
1006722094 6:36162142-36162164 TAAAGTACATGCAAATTAAGGGG - Intergenic
1006746471 6:36346339-36346361 TGCATTATATGCAAATTAAGGGG - Intergenic
1009649991 6:66463331-66463353 TTAATTACATAAAAATTAAGGGG - Intergenic
1009757019 6:67953250-67953272 TTAATTACATGCAAATTAAGAGG - Intergenic
1009973458 6:70649111-70649133 ACAATTACATTCTAATTAACTGG - Intergenic
1010616607 6:78020586-78020608 TCAATTACATGCAAATTAAGGGG - Intergenic
1010675916 6:78742772-78742794 ACAATTGCATGCAAATTAAGGGG - Intergenic
1010866608 6:80983357-80983379 TTAATTACATATAAAGTAAGGGG - Intergenic
1010869437 6:81019987-81020009 TAAATGACATGCAAATTAAATGG + Intergenic
1010870144 6:81026713-81026735 TTAATTACATACAAATTAAGAGG + Intergenic
1010889541 6:81289439-81289461 TCAATAAAATGTAAATTATGTGG + Intergenic
1011178603 6:84593103-84593125 TTAATTATATGCAAATTAAGGGG + Intergenic
1011545403 6:88477418-88477440 TCAATTATATGTAAATTAAGGGG + Intergenic
1012772355 6:103454964-103454986 TTAATTACATGCAAGTTAATGGG - Intergenic
1013420678 6:109963891-109963913 TTAATTACATGCAAAATAAGGGG - Intergenic
1013509371 6:110830551-110830573 TTAATCACATGCAAATTAAGGGG - Intronic
1013708271 6:112865380-112865402 TTAATGACATGCTAATTAAGGGG + Intergenic
1013790999 6:113836401-113836423 TCAAATAAATTAAAATTAAGTGG - Intergenic
1013797356 6:113902433-113902455 TCAATTAAATGTAAATTTATGGG - Intergenic
1013824580 6:114195902-114195924 TCTAATACATGCACAGTAAGGGG + Intronic
1013881648 6:114909519-114909541 TAAAATTCATGCAAATAAAGAGG + Intergenic
1014167699 6:118244459-118244481 TAAATTACATGCAGATTAAGGGG + Intronic
1014589712 6:123248593-123248615 ACAACTACATGCTAATTAACTGG + Intronic
1014916808 6:127160582-127160604 TTAATTAGATGCAAATTAAGGGG + Intronic
1014934176 6:127366718-127366740 TTAATTATATTAAAATTAAGGGG + Intergenic
1015771342 6:136771558-136771580 TTAATTGCATGCAGATTAAGGGG - Intronic
1016519573 6:144931444-144931466 TCAGTTACATGTGAATTAAGAGG + Intergenic
1016548056 6:145246355-145246377 TTAATTATATGCAAATTAAGGGG - Intergenic
1016571941 6:145523279-145523301 TCAATTACATGAAAATTCAAGGG + Intronic
1017053255 6:150413921-150413943 TTCATTACATACAGATTAAGGGG + Intergenic
1017138027 6:151165213-151165235 ACAATGACCTGCAAAGTAAGAGG - Intergenic
1017151596 6:151285603-151285625 TCAATTTCATGCAAAAAAGGGGG + Intronic
1017230454 6:152068016-152068038 TAAATTAAATACAAACTAAGAGG + Intronic
1017385514 6:153878347-153878369 TTAATTTCATGCAAACTAAGGGG + Intergenic
1017736487 6:157369514-157369536 TTAATTACATGCAGATTAAAGGG - Intergenic
1017935950 6:159005326-159005348 TCAGTTCCTTGCAAATTAAATGG - Intergenic
1018080240 6:160253302-160253324 TTAATTATATGCAAATTAAGGGG + Intronic
1018158522 6:161013772-161013794 TCAATTACATGTAAATTAAGGGG + Intronic
1018194444 6:161342929-161342951 TCAATTACACCCAAATTAAAAGG + Intergenic
1018207895 6:161452685-161452707 GCAACTACAAGCAAATTGAGAGG - Intronic
1018262702 6:161986172-161986194 GTAATTACATGCAGATTAAGGGG - Intronic
1018536365 6:164824912-164824934 TTAATCACATGCAAATTAAAGGG - Intergenic
1018735452 6:166684337-166684359 TAAATTACATGTAGATTAAGGGG - Intronic
1018989719 6:168664715-168664737 TCCTTTACTTGCAAATTGAGAGG - Intronic
1019355750 7:577941-577963 TAAATTATGTGCACATTAAGGGG + Intronic
1019642143 7:2109222-2109244 TCAATTACATGCAACTTCCCCGG + Intronic
1019674189 7:2301571-2301593 TTAATTATATGCAAACTAAGGGG + Intronic
1019954334 7:4401413-4401435 TTAATTACCTGCAAATTAAGGGG + Intergenic
1019956059 7:4415302-4415324 TTAATTACATACAAATTAAGGGG + Intergenic
1020782037 7:12529932-12529954 TTAACTACATGCAAATTAAGGGG + Intergenic
1020856786 7:13437094-13437116 TTAATTACATACAAATCAAGAGG + Intergenic
1021016762 7:15545160-15545182 TCAATTTCATGAAATTTAAAAGG + Intronic
1021477899 7:21083437-21083459 TTGAATAAATGCAAATTAAGAGG - Intergenic
1021535882 7:21703858-21703880 TAAATTACGAGGAAATTAAGAGG - Intronic
1021650427 7:22827820-22827842 TTAATTATATGCAAATTAAGGGG - Intergenic
1022007660 7:26281016-26281038 TTAATTACATGCAAATTAAGGGG - Intergenic
1022687808 7:32612935-32612957 TTAATTATACGCAAATTAAGGGG + Intergenic
1022716692 7:32905391-32905413 GTAATTATATGCAAATTAAGGGG + Intergenic
1023068306 7:36401973-36401995 TTAATTGCATGCACATTAAGGGG - Intronic
1023170845 7:37388953-37388975 TCAAAAACATGGAAATTATGTGG - Intronic
1024039964 7:45545069-45545091 TTAATTATATGCTAAATAAGGGG - Intergenic
1024104827 7:46072293-46072315 TCAAGTCCATGAAAATTGAGGGG + Intergenic
1024435953 7:49354779-49354801 TTAATTATGTGCAAATTAAGGGG + Intergenic
1024652690 7:51419171-51419193 TTAATTAGATGCTAATTAAGGGG + Intergenic
1024747674 7:52427181-52427203 ACAATTACATGCAAATTAAAGGG - Intergenic
1024806442 7:53147322-53147344 TCAATTGCATGCAGACTAAGGGG + Intergenic
1024892106 7:54215653-54215675 GCAACTACATGCCAATTAATCGG + Intergenic
1025003570 7:55338440-55338462 TCAATTACAAGCAAACTACCAGG + Intergenic
1025037870 7:55609810-55609832 TTAATTAGATGCTAATTAAGGGG + Intergenic
1025741968 7:64204992-64205014 TCAATTATATGCTAACCAAGGGG + Intronic
1026009490 7:66625789-66625811 TTAATTATATGCAAATTGAGGGG - Intergenic
1026076807 7:67179147-67179169 ATATTTACATGCAAATTAAGGGG + Intronic
1026219294 7:68378645-68378667 TCAATTACCTGGAAACCAAGTGG - Intergenic
1026236246 7:68529525-68529547 TTAATTATATACAAATTAAGGGG - Intergenic
1026535106 7:71232746-71232768 TTAATTACACGCAAATTAAGGGG + Intronic
1026679327 7:72453355-72453377 TTAATTACATGCAAATTAAGGGG + Intergenic
1026700055 7:72633192-72633214 ATATTTACATGCAAATTAAGGGG - Intronic
1026877726 7:73889172-73889194 TCAATTATATGCAAATTAAGGGG - Intergenic
1027127386 7:75566446-75566468 TTAATTATATGTAAATTAAGGGG + Intronic
1027250594 7:76396392-76396414 TCAAGTATATGCAAATTAGGGGG - Intronic
1027569721 7:79848950-79848972 TCAATTTCTTGCAAATTATGAGG + Intergenic
1027797487 7:82712733-82712755 TCAATTACAACCAAAATAAAAGG - Intergenic
1027872398 7:83724426-83724448 TAAATTACATCCCAATAAAGTGG - Intergenic
1027874981 7:83757108-83757130 TCACTTAAATGCAAATGAAAAGG + Intergenic
1028075065 7:86502504-86502526 TTAATTGCATGCAGATTAAGTGG + Intergenic
1028317905 7:89427045-89427067 TCAATTATGTGCAAATTAATGGG + Intergenic
1028383378 7:90224390-90224412 TGATTTATATGCAAATTAAGGGG - Intronic
1028609881 7:92698860-92698882 TTAATTACATGAATATTAAGAGG - Intronic
1029161208 7:98553426-98553448 TTGATTACCTGCAAATTAAGAGG - Intergenic
1029188129 7:98754070-98754092 TTAATTATATGCAAATTAAGGGG + Intergenic
1029213660 7:98929520-98929542 GCAATTATGTGTAAATTAAGTGG - Intronic
1029350184 7:100007900-100007922 TTAATTACGTGTAGATTAAGGGG + Intergenic
1029381306 7:100216838-100216860 TCAAAAACAGGCAAATCAAGTGG + Intronic
1029427658 7:100506623-100506645 TTAATTATATGCAAATTAAGGGG + Intergenic
1029570916 7:101368548-101368570 TTAACTATATGCAAATTAAGGGG + Intronic
1029576662 7:101407852-101407874 TTAATCATATGCAAATTAAGGGG + Intronic
1029618817 7:101677258-101677280 TTAATTACATGCAAATGAAGAGG - Intergenic
1029956070 7:104641589-104641611 TCCATTACATGAAAAATGAGAGG + Intronic
1030222215 7:107109040-107109062 TTAATTACATGCTAAATAAGGGG + Intronic
1030542585 7:110850437-110850459 TCAGTTATATGTAAATCAAGGGG - Intronic
1030690509 7:112527826-112527848 TTAATTATATGCTAAATAAGGGG - Intergenic
1030856240 7:114561131-114561153 CCAATTACATGCAAATTGGTGGG - Intronic
1030900860 7:115121386-115121408 TAAATTACATGTAAATTAAGGGG - Intergenic
1031095239 7:117409609-117409631 TGAATAACATACAAATTAAGGGG + Intronic
1031402473 7:121342047-121342069 TCCATTACTTGCAACATAAGGGG - Intergenic
1031823701 7:126535565-126535587 TCAATTGCATGCAGAGTAAGGGG + Intronic
1032198291 7:129801975-129801997 TTAAGTACATGCAAATTAAGGGG + Intergenic
1032436468 7:131905048-131905070 TTAATTACATGTAGATTAAGAGG - Intergenic
1033939481 7:146634440-146634462 TGAATTACATATAAATTACGTGG - Intronic
1034110003 7:148527633-148527655 TTAATTACATGCAAATTAAAGGG + Intergenic
1034383998 7:150722766-150722788 TCAACTATATGCAAATTTAGGGG + Exonic
1034707336 7:153157293-153157315 TTAATTACATGCAAATTAAGGGG - Intergenic
1034974016 7:155437450-155437472 TTAATTATATGCAAATTGAGGGG + Intergenic
1035813278 8:2511610-2511632 TTAATTATATGCTAATTAAGGGG + Intergenic
1035819926 8:2580157-2580179 TTAATTATATGCAAATTAAGGGG + Intergenic
1036063175 8:5348395-5348417 TTAATTATACGCAAATTAAGGGG + Intergenic
1036105440 8:5833243-5833265 TTAATCATGTGCAAATTAAGGGG + Intergenic
1036125947 8:6062043-6062065 TTAATTACATGCACATTAAAGGG - Intergenic
1036137259 8:6173733-6173755 TTAATAGCATGCAGATTAAGGGG - Intergenic
1036378158 8:8218515-8218537 TTAATTGCATGCAGATTAAAGGG - Intergenic
1036732289 8:11276566-11276588 TTAATTACATGCAAATTACGGGG - Intergenic
1036739108 8:11345974-11345996 TTAATTGCATACAGATTAAGGGG + Intergenic
1036851408 8:12204102-12204124 TTAATTGCATGCAGATTAAAGGG + Intergenic
1036872773 8:12446376-12446398 TTAATTGCATGCAGATTAAAGGG + Intergenic
1036913061 8:12775094-12775116 TCAATGATATGCTAATTAAGAGG - Intergenic
1036926633 8:12913287-12913309 TTGATTACATGCGAATTAAGGGG + Intergenic
1037198761 8:16224218-16224240 TTAATTATATGCAAATTAAAGGG - Intronic
1037247928 8:16857998-16858020 TTAATTACATGTAGATTAAGGGG + Intergenic
1037471463 8:19215437-19215459 TCAATTATATGTAAATTAAGGGG - Intergenic
1037600351 8:20388715-20388737 TTAATCACATGCAAATTAAGGGG + Intergenic
1037983010 8:23268563-23268585 TTAATTATATGCAAATCAAGGGG - Intergenic
1038223405 8:25632109-25632131 TTAGTTACATGCAGATTAAGGGG + Intergenic
1038375204 8:27033144-27033166 TCAATTGCATGCAAATAAAGGGG + Intergenic
1038448983 8:27626790-27626812 TTAATTATATGCAAATTAAGGGG - Intergenic
1038560153 8:28569607-28569629 TCATTTACATGTAAATTGATGGG + Exonic
1038865645 8:31436286-31436308 CCAATTACATGCCCATTATGAGG + Intergenic
1039152332 8:34520144-34520166 TCAATGCCATAAAAATTAAGAGG + Intergenic
1039324992 8:36475204-36475226 TTAATTACATGCAAATTAAGGGG + Intergenic
1039338701 8:36623152-36623174 TTAATTGCATGTAGATTAAGGGG - Intergenic
1039847181 8:41333872-41333894 TTTATTACATGCAAATTAAAGGG - Intergenic
1040011409 8:42664092-42664114 TTAATGACATCCAAATTAAGGGG - Intergenic
1040018084 8:42716569-42716591 TTAATTATATGCAAATTAAGAGG + Intronic
1040800074 8:51330632-51330654 TCAACTACATTCACATTATGAGG + Intronic
1041014532 8:53579171-53579193 TCAATTACATGCAAACTAAGTGG + Intergenic
1041840667 8:62266841-62266863 TTAATTATATACAAATTAAAGGG - Intronic
1042156651 8:65851372-65851394 TTAATTATATGCAAATTAAGGGG - Intergenic
1042518500 8:69684615-69684637 TTAATTATATACAAAATAAGGGG - Intronic
1042727230 8:71891061-71891083 TCAATTATATGCTAAACAAGGGG - Intronic
1042761047 8:72271736-72271758 TTAATTACATGCAAATTAGGGGG - Intergenic
1043015613 8:74936796-74936818 GCAAGTACATGCAAATAAATTGG - Intergenic
1043217692 8:77615606-77615628 ACAATTACAAACAAATTGAGAGG + Intergenic
1043754124 8:83980852-83980874 TGAATCACATGCAAAATAAGTGG + Intergenic
1043754520 8:83986056-83986078 TTAACGACATGCTAATTAAGAGG - Intergenic
1044137362 8:88604046-88604068 TTAATTACATGCAAATTAAGGGG + Intergenic
1044155687 8:88843596-88843618 TTAATTACATGCAAATTAAGTGG + Intergenic
1044352345 8:91181521-91181543 TAACATACATGCAAACTAAGTGG + Intronic
1044492984 8:92842616-92842638 TTAATTATATGCAAATTAAAGGG + Intergenic
1044685407 8:94821693-94821715 TTAATTGCATGCAGATTAAGGGG - Intronic
1045010728 8:97956483-97956505 TTAACTGCATGCAGATTAAGAGG + Intronic
1045012477 8:97970165-97970187 TCAATTGCAGGCACGTTAAGGGG + Intronic
1046262010 8:111780924-111780946 CCAATTACATGATAGTTAAGAGG + Intergenic
1047534158 8:125704029-125704051 TTAGTAACAAGCAAATTAAGGGG + Intergenic
1047593576 8:126353144-126353166 TAAATTACATGCAAATCAGAAGG + Intergenic
1047942086 8:129836175-129836197 TTAATTATATGCTAAATAAGGGG + Intergenic
1048468838 8:134689250-134689272 TCAATGACGTGCTAATTAAGGGG - Intronic
1048552572 8:135447485-135447507 TCAATGACATGAAAAGTAATTGG - Intergenic
1049227277 8:141461536-141461558 TTAATTATGTGCAAATTACGGGG - Intergenic
1049345900 8:142138477-142138499 CCAAATTAATGCAAATTAAGGGG - Intergenic
1049429647 8:142554609-142554631 TTAATCGTATGCAAATTAAGGGG + Intergenic
1049627378 8:143631377-143631399 TTAATCATATGCAAATTAAGGGG + Intergenic
1049678620 8:143905005-143905027 TTACTTACATGCAAATTAAGGGG - Intergenic
1050920099 9:11189410-11189432 TTAATTACATGCAAATTATTGGG + Intergenic
1051011159 9:12416211-12416233 TCAATTACATGCAAATTAAGGGG + Intergenic
1052126709 9:24784877-24784899 TCAATTAGATGCAACTTGTGGGG + Intergenic
1052131643 9:24855613-24855635 TAAATTATGTGCAAATTAAGGGG - Intergenic
1052135614 9:24906365-24906387 TTAATTACATGCAAATTAAGGGG + Intergenic
1052149247 9:25093110-25093132 TTAATAAAATGCTAATTAAGAGG + Intergenic
1052332150 9:27281128-27281150 TTAATTGCATGCTAATCAAGGGG - Intergenic
1052332175 9:27281336-27281358 ACAATTACAGGCTAAGTAAGGGG - Intergenic
1052344671 9:27397412-27397434 TCAAATAAATGCAAATCAATAGG + Intronic
1052433059 9:28392266-28392288 TCAATTAGATCCTAATTAATAGG - Intronic
1052565159 9:30140476-30140498 TTAATTATATGCTAATTATGGGG - Intergenic
1052856678 9:33411226-33411248 TTAATTGTATGCAGATTAAGAGG - Intergenic
1053044445 9:34903189-34903211 TCTATTTCATTCAAGTTAAGAGG + Intergenic
1053125135 9:35574969-35574991 TTAACTACATGCAAATTAAGGGG - Intergenic
1053572268 9:39321251-39321273 TTAATTACATGCAGATTCAGGGG - Intergenic
1053623661 9:39845787-39845809 TTAATTACATGTAGATTCAGGGG - Intergenic
1053881208 9:42597441-42597463 TTAATTACATGTAGATTCAGGGG + Intergenic
1053891455 9:42696872-42696894 TTAATTACATGCAGATTCAGGGG - Intergenic
1054093828 9:60879962-60879984 TTAATTACATGCAGATTCAGGGG - Intergenic
1054124877 9:61297760-61297782 TTAATTACATGCAGATTCAGGGG + Intergenic
1054220237 9:62404912-62404934 TTAATTACATGTAGATTCAGGGG + Intergenic
1054230478 9:62504260-62504282 TTAATTACATGTAGATTCAGGGG - Intergenic
1054934993 9:70677281-70677303 TTAATTATATGTAGATTAAGGGG - Intronic
1055033790 9:71796629-71796651 TAAATTACATGCAAATCAAGGGG - Intronic
1055079490 9:72255206-72255228 TCAATTACATGCAAATTAACGGG + Intronic
1055163150 9:73156560-73156582 GCAATCCCATGCGAATTAAGTGG + Intronic
1055464731 9:76553275-76553297 TCAATTCACTGCAAATTGAGAGG - Intergenic
1055984657 9:82045062-82045084 ACAATTATATGCCAATAAAGTGG - Intergenic
1056054896 9:82811344-82811366 TTAATGACATGCTAAATAAGGGG - Intergenic
1056242246 9:84659537-84659559 GTAATTACATGCAAATTAAGGGG - Intergenic
1056283152 9:85062126-85062148 TCATATTTATGCAAATTAAGGGG - Intergenic
1056618661 9:88191424-88191446 TTAATTACATGCAAAATTAAGGG + Intergenic
1056727922 9:89138349-89138371 TCAATTATATGCTAAATAAGGGG + Intronic
1056918340 9:90763549-90763571 TTAATTACTTGCAAATTCAGGGG + Intergenic
1056919040 9:90769937-90769959 TTAATTACATGCAAATTAAGGGG + Intergenic
1057931580 9:99198115-99198137 TGAATTACAAGCGAATGAAGTGG + Intergenic
1058194589 9:101956911-101956933 TTAATGACATGCTAATTAAGGGG - Intergenic
1059420562 9:114188198-114188220 TTAATTATATGCAAATTAAGAGG + Intronic
1059689306 9:116669237-116669259 TTAATTACATGCAAATTAAGGGG - Intronic
1059978385 9:119742696-119742718 TTAATTATATGCAAATTAAGGGG - Intergenic
1060538967 9:124416392-124416414 TTAATTACATGCAGATTAAGGGG - Intergenic
1061853134 9:133427819-133427841 CTAATTATATGCAAATTAAGGGG + Intronic
1062139875 9:134950078-134950100 TTAATTACAAGCAGATTAAGGGG + Intergenic
1062149512 9:135010370-135010392 TTAATTGCATGCAGATTAAGGGG + Intergenic
1203689436 Un_GL000214v1:28978-29000 TTAATGGCATGCTAATTAAGGGG + Intergenic
1203753187 Un_GL000218v1:98816-98838 TTAATGACATGCTAATTAAGGGG - Intergenic
1203712601 Un_KI270742v1:111371-111393 TTAATGGCATGCTAATTAAGGGG - Intergenic
1203538622 Un_KI270743v1:66834-66856 TTAATGGCATGCTAATTAAGGGG + Intergenic
1203556195 Un_KI270743v1:209690-209712 TTAATGGCATGCTAATTAAGGGG - Intergenic
1203646839 Un_KI270751v1:75075-75097 TTAATGGCATGCTAATTAAGGGG - Intergenic
1185523530 X:759753-759775 CCAATTACATGCAAATTAAGGGG - Intergenic
1185562870 X:1073058-1073080 CTAATTACATGCAAATGAAGGGG - Intergenic
1185682373 X:1899101-1899123 CTAATTACATGCAAATGAAGGGG + Intergenic
1185803461 X:3034550-3034572 TTAATTGCATGCAGATTAATGGG + Intergenic
1185857598 X:3550476-3550498 CTAATGGCATGCAAATTAAGGGG - Intergenic
1186010411 X:5125432-5125454 TTAATAACATGCAAATTAAGGGG - Intergenic
1186045691 X:5534205-5534227 TTAATTACATGCAGATTAAGGGG - Intergenic
1186160647 X:6773823-6773845 TTAATTTCCTGCAGATTAAGGGG - Intergenic
1186536875 X:10359164-10359186 TTAATTACATGCAAATTAAAGGG + Intergenic
1186604113 X:11071065-11071087 TTAATTATATGCAAAATAAGGGG - Intergenic
1188055821 X:25540281-25540303 TCACTTCCAGGCAAACTAAGGGG + Intergenic
1188672635 X:32898568-32898590 TCAATTACATGTAAATTAAGTGG + Intronic
1188928158 X:36070937-36070959 TTAATTGCATGCAGATTAAGGGG - Intronic
1189128842 X:38477708-38477730 TCACATACATCCAAATTGAGGGG - Intronic
1189650910 X:43188503-43188525 TTAATTACATGCAAATTAAGGGG - Intergenic
1190364635 X:49680088-49680110 TCAATCACATGCAAATTAAGGGG + Intergenic
1190379180 X:49822065-49822087 TCAATTAAACTCAAATTGAGGGG + Intergenic
1190392811 X:49948972-49948994 TGTATTAAATGCAAATTAATTGG + Intronic
1190467213 X:50737359-50737381 TCAATGACATTAAATTTAAGTGG + Intronic
1190554764 X:51623061-51623083 TCAATTACCTGCAAATTAAGGGG + Intergenic
1190682071 X:52834978-52835000 TCAGTTCCATGTAAATGAAGGGG + Intergenic
1190958657 X:55222756-55222778 TCAATAAGATGCAAATTATAGGG + Intronic
1192247018 X:69381338-69381360 TCAATTATCTGCAGATAAAGAGG - Intergenic
1192416818 X:70988498-70988520 TCAGTTACATGCAAATTAAGGGG + Intergenic
1192595141 X:72398786-72398808 TCAATTACCTTAAAATGAAGTGG - Intronic
1193830623 X:86284913-86284935 TCAACTACATGCCAATAAATTGG - Intronic
1194067161 X:89275988-89276010 TTAATTACATGCAAATGAAGGGG + Intergenic
1194152787 X:90345677-90345699 ACGATTACATGCAAATTAAGGGG + Intergenic
1194571827 X:95561886-95561908 TTAATTATATGCAAATTAAGGGG + Intergenic
1194937332 X:99966577-99966599 ACAATTACATGCCAATAAATTGG - Intergenic
1195267889 X:103201209-103201231 TTAGTTACATGCAAATTAAGGGG - Intergenic
1195313083 X:103653033-103653055 TTACTTATATGCAAATTAAGTGG + Intergenic
1195314066 X:103660603-103660625 TTAATTATATGCAAATTGAGGGG + Intergenic
1195314188 X:103661873-103661895 TTAATTATATGAAAATTAATGGG + Intergenic
1195373928 X:104207045-104207067 TCAATTACATGCAAATTAAGGGG + Intergenic
1195389219 X:104343669-104343691 TCAATTACATGCAAATTAAGGGG + Intergenic
1195446129 X:104955008-104955030 TTAATTATATGCAAATTAGAGGG + Intronic
1195448257 X:104977840-104977862 TTTATTATATGCAAATTAAGGGG + Intronic
1198175283 X:134148630-134148652 TTAATTGCATGCAGATTAATGGG - Intergenic
1198179343 X:134190357-134190379 TCTATTTCCTGCAAACTAAGTGG - Intergenic
1198272693 X:135069203-135069225 TTAATTGCATGCAAATTAAGGGG - Intergenic
1198846589 X:140918764-140918786 TTAATTATATGCAAATTAAGGGG - Intergenic
1198928525 X:141826043-141826065 TTAATTATATGCTAACTAAGAGG + Intergenic
1199341669 X:146685292-146685314 GCAACTACATGCAAATAAATTGG - Intergenic
1199369078 X:147023717-147023739 CAAAGTACATACAAATTAAGAGG + Intergenic
1199687497 X:150277458-150277480 TTAGTTGCATGCAGATTAAGAGG + Intergenic
1199782849 X:151079041-151079063 TCAAATACAAGCAAATGAGGAGG + Intergenic
1200498391 Y:3914666-3914688 TCAATTACAAGCAAAATGGGAGG - Intergenic
1200499131 Y:3922422-3922444 ACGATTACATGCAAATTAAGGGG + Intergenic
1200721322 Y:6610197-6610219 TTAATTACATGCAAATGAAGGGG + Intergenic
1201166831 Y:11216385-11216407 TTAATGACATGCTAATTAAGGGG - Intergenic
1201256697 Y:12114515-12114537 TCAATTATATGCAAGTTATGTGG + Intergenic
1201269685 Y:12242737-12242759 TTAATTGCATGCAGATTAAGGGG + Intergenic
1201599036 Y:15707268-15707290 TCAACTACATCCTAATTCAGGGG - Intergenic
1201669356 Y:16500016-16500038 TTAATTACATGCAAATGAAGGGG + Intergenic
1201992071 Y:20038167-20038189 ACAATTATATGCAAATAAACTGG + Intergenic